Answered: An ecosystem is made up of onlyl trees…

An ecosystem is made up of onlyl trees and animals in a habitat all living organisms (unicellular and multicellular) biotic and abiotic components flora, fauna and bacteria

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter51: Ecology And The Biosphere

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Related questions

Q: You are conducting an experiment studying sex linked traits. I. The experiment you cross 2 different…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: "Tobacco smoking triggers a large number of somaticmutations and epigenetic changes". Define about…

A: Mutations are any change in the DNA sequence of a gene that is coding for a specific protein in a…

Q: Ron is colorblind which is an X linked recessive condition. He may have gotten this condition from…

A: As per the guidelines, we have answered the first question only. Please repost the other question…

Q: A fishing spider walks along the surface of water to hunt for tadpoles. Which characteristic of…

A: The two emergent properties of water includes; Cohesion - it is the hydrogen bonding of water…

Q: Give the examples of epigenetic modifications ?

A: Genetic changes are the ones that are regulated by genes.

Q: 4. Into what cavity does the blastopore open? The gastrular slit? What becomes of each? 5. Explain…

A: Introduction : The initial gut that develops during the gastrula stage is called the archenteron.…

Q: . - thick muscular layer that spirals around the heart Endocardlum - lines the interior of the…

A: Introduction There are four chambers in the heart. The lower two chambers are known as ventricles,…

Q: A study was done with mice to see if there is a biological basis behind compatibility in friends and…

A: Social integrity: This element of Levine's theory emphasizes the relevance of interpersonal or…

Q: A cross was made between a black male dog and two different white females. The first female gave…

A: Given information A black male dog is crossed with different white females. From 1st cross, 8 white…

Q: After reading the scenario,fill in the table with the following information.

A: Scientific research methods involve following step-by-step procedures and approaches to research…

Q: Students are performing an experiment to understand the transfers of carbon between a photosynthetic…

A: BTB is a pH indicator, it is of blue colour and as the pH decreases or the solution becomes acidic…

Q: Which statement is TRUE?

A: Viruses are nonliving cells that complete their life cycle by infecting host cells. They have sizes…

Q: 1. Graded potentials are short lived and travel only short distances. Action potentials are long…

A: Graded potential: its the change in electric potential across the membrane of an excitable cell like…

Q: quick burst of energy?

A: Note : As in the questions mentioned above, the answers for 2,4,5,6,7 are already solved and there…

Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…

A: The simplest definition of gene expression is the production of the gene's complementary protein,…

Q: Joey has type A blood, a type B mother and is Rh negative. Joey has children with Maxine who has…

A: Introduction : Landsteiner studied the properties of blood cells and the proteins on the surface of…

Q: 1. list all the similarities between DNA and chromosome

A: The nucleic acids found in the cells are DNA and RNA. DNA resides in the nucleus while RNA can be…

Q: what do you think is the coolest metabolic process for energy-producing nutrients?

A: All living organisms require energy for various living processes such as growth, reproduction,…

Q: If a person who was a regular cocaine user were to stop suddenly, do you think they would receive…

A: The continuous use of drugs like cocaine results in addiction and has a lot of side effects like…

Q: Od ammonification QUESTION 13 The geothermal gradient is due to a decaying radioactive elements that…

A: Introduction :- The rise in temperature with depth in the Earth's crust is known as the geothermal…

Q: Illustrate the development of colorectal cancer ?

A: Any of the several illnesses characterised by the growth of aberrant cells that divide out of…

Q: Show the gametes produced by illustrating the phases of meiosis (a) AAbbCc (b) AaBbCcDd

A: Introduction : Gametes are also known as sex cells. An individual's gametes are their reproductive…

Q: A phage that reproduces slowly, produces relatively few phage particles, and only undergoes the…

Q: Place the steps of viral replication in the correct order Start 1 2 32 4 5 Macromolecular synthesis…

A: Viral replication is the formation of biological viruses in the target host cells during the…

Q: What is a possible function of cytoplasmic streaming in the slime mold? To help distribute and…

A: Introduction : Protists known as slime moulds are saprophytes. Their anatomy is designed for moving…

Q: How does the slope of a line on a graph indicate rate (such as rate of transpiration)

A: The graph is consists of x-axis that has independent variable, y-axis that has dependent variable…

Q: What are Differentiated cells ?

A: All living beings are composed of one or more cells.

Q: What is loss of heterozygosity ?

A: The term heterozygous means the combination of alleles in an individual has one allele of a gene as…

Q: How do feedback mechanisms control the secretion of hormones?

A: Hormones are chemical messengers which are produced by the various glands in the human body and…

Q: Proto-oncogenes can be converted to oncogenes in a numberof different ways. In some cases, the…

A: Cancer is caused by the activation of a group of genes called proto-oncogenes (which are actually…

Q: For most cell types, serum must be added to the media to get cells to grow and proliferate in…

A: In humams serum is the plasma without clotting factors. Which means that plasma contains antibodies,…

Q: How do the moss gametophyte and sporophyte stages obtain their energy?

A: Introduction Moss belongs to the kingdom plantae and division bryophyta. Mosses are the…

Q: what are some case scenarios for musculoskeletal system

A: Skeletal muscle tissue's major function is to move the body by pushing on the skeleton's bones,…

Q: Bacteriophage Lambda Describe the procedures you used to retrieve your gene of interest from the…

A: Bioinformatics gives information about the application of the intricacies of biological information.…

Q: The ability of water molecules to form hydrogen bonds with other water molecules is critical to: O…

A: Hydrogen bonds form when hydrogen atoms covalently bonded to nitrogen (N), oxygen (O), or fluorine…

Q: The endogenous ligand for an ion channel causes the influx of 50 Na+ ions per second. This ion…

A: Full agonist Drugs that bind to the target receptor with affinity are considered agonists, and they…

Q: There are check points in the entrance and exit of the city, they are like which part of the cell?*…

A: An organelle is a subcellular structure that, like an organ, has one or more specific jobs to do in…

Q: Which event may take place before metaphase separation of sister chromatids DNA replication O…

A: Cell division is the process in which a parent or the mother cell divides into two or more daughter…

Q: Differentiate between the “hot method” and “cold method” of acid-fast staining.

A: Introduction A physical characteristic of several bacterial and eukaryotic cells, as well as some…

Q: Which characteristic of water makes it a universal solvent? A. O weak bonds B.O polarity G.O…

A: Introduction Almost 75% of the human body is composed of water. About 70% of the earth's surface…

Q: LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these…

A: Transcription Synthesis of mRNA from DNA Translation Converting genetic information into…

Q: Pentose Phosphate Pathway. Q3.3-Glucose-6-phosphate (G6P) is a central metabolite in carbohydrate…

A: Introduction : Pentose phosphate pathway : Glycolysis produces the first 6-carbon molecule…

Q: What does translucent spot mean with regards to lipid? Identify the control for this test. 1.…

A: Introduction Lipids are macromolecules like proteins, nucleic acids, and carbohydrates. These are…

Q: How Metastatic tumors arise ?

A: The tumor is the term given to the mass of cells or tissues formed when the cells of that tissue…

Q: Given an equal amount of photons, what is the order of increasing effectiveness of blue, red, green,…

A: Photosynthesis The production of glucose molecules by green plants in the presence of sunlight.

Q: Two alternative 3' cleavage sites will result in: A. genes of different length. B. pre-mRNA…

A: Introduction Living cells and organisms reproduce and transmit the characters from generation to…

Q: A nutritionist is interested in collecting data to develop a healthy eating program at a local high…

A: A graph is a pictorial representation or diagram that represents data or values in an organised way.

Q: Habitat of metamonads

A: Introduction Habitat is referred to the place where any species resides. This can be any…

Q: Describe how to use a micropipette.

A: Introduction Biology is a branch of science. Bio means life and ology means study. Biology is the…

Q: 1. An experimental study is conducted to determine whether a new drug reduces high blood pressure.…

A: In the context of research study a variable is defined as any feature with the potential to change,…

Concept explainers

Communities and Ecosystems

Ecology contains two words: Eikos means dwelling, and logy means to study, so the combined meaning is studying habitat or living.

Question

An ecosystem is made up of
onlyl trees and animals in a habitat
all living organisms (unicellular and multicellular)
biotic and abiotic components
flora, fauna and bacteria

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introductton

VIEW

Answer

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Science Name: Date: Class: Range of Tolerance Data Analysis One of the responsibilities of an aquatic biologist is to make sure that the abiotic factors stay wiumh the acceptable ranges for the optimal help for the Species within the local ecosystem. Bcologists, including aquatic biologists, use the range of tolerance to monitor the number of different populations residing in the area. m order to do so they use statistical models. Create a graph displaying on the x-axis the ranges of abiotic conditions such as temperature to study the population of rainbow trout in the area ( use the launch model as an example), Label each interval with temperature range and condition. What Causing Stress in Rainbow Trout Population The optimal range is the amount of an abiotic factor that produces the highest possible population. For water temperature, this would be about 6-10°C. Label this area on the graph. 1. 2. The zone of physiologic stress occurs when an abiotic factor exists at levels that are…
All living organisms and their interactions which the surrounding environment Biome Landscape Ecosystem Habitat
The source of the necessary elements of life isa. an inorganic environmental reservoirb. the sunc. rocksd. the air
An ecosystem includes: (Select all that apply.) the interacting organisms in the area. O abiotic factors of the area. closely related organisms in a different area. predators in the area.
Organization of the Biosphere eeh's biosphere is made up of ecosystems. An ecosystem includes all of the biotic and ahiotic components in a given area. The living components in an ecosystem are called bietic factors. The nonliving components of ecosystems are abiotic factors. Energy and matter cycle through these various components. Similar to other systems, an ecosystem also has feedback mechanisms that keep it balanced and restore it to a balanced state when disrupted. INFER Write the correct term in the appropriate box: biome biosphere community ecosystem organism population Ecologists can study ecosystems at different scales. They may study an individual organism, such as a mule deer, to learn more about factors that affect that species. They may also study an entire population of mule deer. A population is a group of the same species that lives in the same area. Multiple populations of different species form a community, In the Sierra Nevada, an ecologist may study how a community…
As the biological hierarchy builds from molecules on up to the ecosystem each level has
What type of biomes are in nroth aermcia the four regions I know thier is wester region is huge as the biomes it have are grand canyon, huge woodland, and snow with forest middle wester region has badlands and i thik great plains what about east regiona nd south region i think i got this all wrong
How can a great biologicaldiversity protect an ecosystemfrom environmental damage?Why are less biodiverseecosystems at risk of sufferingdeep biological harm ifsubmitted to even smallchanges?
Which of the following representations most closely resembles an ecosystem? A group of house cats An empty apartment complex O The washing machines, furniture, and house cats in an apartment complex The furniture and vending machines in an apartment complex
An ecosystem consists of: All the species in a biological community A biological community and its physical environment The species with which a biological community interacts The primary producers within a biological community A physical environment within which a biological community lives
Ecology is best defined as the study of how interactions between organisms lead to changes across generations. the study of interactions between organisms. the study of the relationships between organisms and their environment. O the study of the biotic and abiotic environment.
What type of biomes are in nroth aermcia the four regions In middle west region has great plains and i read thier is even badlands, is their more of the biomes What biomes are in east region exactly i know their forest, lake and ponds and hills south region i think its like jungle, swamps and forest and more wester region has likey snow with forest and snow mountain, grand canyon, desert, rivers and more please im trying to learn each region biomes