agriculture is typical in more developed countries (MDCs) and involves growing food to sell on commercial markets. It is characterized by larger farms, fewer farmers, and more sophistication (e.g., mechanization, hybrid and/or genetically modified crops, irrigation, chemical fertilizers, etc.). 1) Intensive subsistence agriculture 2) Pastoral nomadism 3) Commercial 4) Subsistence

Hi, I’m having problem how to find the chi- square analysis I need to learn how to do it please, I been trying but is very hard for mes thank you

ment/d/1d1MOGCJCGjZYwhcUOWDBulan-NwWpIRg/edit utations .DOCX t Tools Help Last edit was 9 minutes ago nal text Times New... | c ñ I a + 二次 =t|^三| 11 1. Will there ikely be etects? 5. What type of mutation is this? 2. 4. Mutated DNA Sequence #2 TACGAC CTTGG CGA C GACT What's the mRNA sequence? amino acid sequence? Will there likely be effects? What type of mutation is this? Mutated DNA Sequence #3 TACA CCTTAGCGA CGACT... (Highlig. What's the mRNA sequence? amino acid sequence? Will there likely be effects? What type of mutation is this? Mutated DNA Sequence #4 TACAC CTTGG CGACTACT... (Highligh. What's the mRNA sequence? amino acid sequence? Will there likely be effects? What type of mutation is this? dy

Peppered moths

I need help matching these. Thank you so much

tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letter

Help answer 5

Hello, I need help answering 8b & 8c using the graph below. Pls & thank you! 8. b) Fossil evidence shows that it was not until the evolution of Homo erectus that the brain size in hominins really began to increase relative to body size. The range in brain size of early Homo erectus to late Homo erectus increased from 700 cc to 1000 cc (similar to the gram scale on the y-axis). This includes most of the 3x increase of brain size from Australopithecus to Homo sapiens. But Homo erectus was about the height of modern humans. Does the graph show that brain size in H. erectus increased faster than body size even though H. erectus was taller than Australopithecus? How can you tell? 8. c) Homo floresiensis (the 3.5 ft-tall “Hobbit” from Flores Island in Indonesia) had a brain similar in size to that of a chimpanzee. But H. floresiensis used tools, including bows and arrows, to hunt pygmy elephants. Is it a good idea to make a cast of the interior of the brain case in skulls of H.…

scleritis usually doesn't cause red eye I need answer within 3 minutes with my best wishes ton .A true .B false

58