Instructions and example attached Instructions:Put the following terms into a word map to explain how they are interrelated forDNA structure and DNA replication.AdenineCytosineDeoxyriboseDNADNA helicaseDNA polymeraseDouble helixLagging strandLeading strandLigaseGuanineNucleotideOkazaki fragmentPhosphatePhosphodiester bondPrimaseGuidelines for building a word map:PrimerReplication forkSemidiscontinuousSingle-stranded binding proteinsTelomereTemplateThymineTopoisomerase IIEach word in the list will be a node on the mapEvery word needs to be connected to at least one other word by a lineAll connecting lines need a few words to describe the relationship between thewords that are being connectedTo figure out the direction of arrows, think of each relationship between words assentences. These examples come from the sample Mitosis/Meiosis word mapbelow:o "Mitosis is a type of cell division"o "Mitosis produces cells that are diploid""Sister chromatids are separated in meiosis" Produces cells that areMitosisAre separated in9,281DiploidA type ofCell divisionSister chromatidsAre not separated inNondisjunctionOCT26OMother cell isA type ofMeiosis IIAre separated inMeiosisDivided intoAre not separated intvHaploidProduces cells that areMeiosis I2Homologous chromosomesCrossing overAre separated inAIncludes@PWU

Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading strand Ligase Guanine Nucleotide Okazaki fragment Phosphate Phosphodiester bond Primase Primer Replication fork Semidiscontinuous Single-stranded binding proteins Telomere Template Thymine Topoisomerase II

Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading strand Ligase Guanine Nucleotide Okazaki fragment Phosphate Phosphodiester bond Primase Primer Replication fork Semidiscontinuous Single-stranded binding proteins Telomere Template Thymine Topoisomerase II

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
pen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorder
match these replication associated terms with the appropriate definition or function. DNA polymerase primase ligase helicase orgin did i do it correctly?
to 4 minutes) The schematic diagram below shows organization of the DNA replication fork. Match parts of the diagram (labeled A-F) with the corresponding term from the answer list (designated 31 parental duplex 5' 3' fork progression v A 1Lagging strand 2. An Okazaki tragment 3.Site of action of DNA topoisomerase 4 Leading strand 5. Site of action of DNA helicCase 6.Site of action of DNA ligase
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…
Match the THE BEST DESCRIPTION with the proper enzyme. RNA Polymerase I RNA Polymerase II RNA Polymerase III DNA Polymerase I aminoacyl-tRNA synthetases DNA Polymerase III RF1 [Choose ] ✓ MAINLY synthesizes ribosomal RNA Recognizes stop codons and halts the process of protein translation The most important enzymes involved in interpreting the genetic code. Part of a processive complex that does most of the work placing nucleotides in DNA replication. Synthesizes messenger RNA precursors MAINLY synthesizes transfer RNA Has 5' to 3' exocnuclease activity and participates in primer removal MAINLY synthesizes transfer Has 5' to 3' exocnuclease act The most important enzyme Part of a processive complex Recognizes stop codons and
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
DNA Replication For the following piece of DNA, draw the replicated piece of DNA show me where the original and replicated strands of DNA end up. A ATCCGTTACCCA A ACGATATC C GTTA AC C GC G ITAG GCA ATGG GTTTG CTATAG GCA ATTGG C G C
Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] Guanine
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.