A sphingoglycolipid has a "head and two tails" structure. Classify each of the following components of a sphingoglycolipid as being part of its "head" or part of its "tails." a. Sphingosine b. Fatty acid c. Monosaccharide d. Oligosaccharide

Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…

A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…

Q: Dehydrogenase reactions in TCA cycle

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…

Q: 4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: What is the pI, and how is it determined for amino acids that have nonionizable R groups?

A: There are twenty amino acids which are categorized as basic, acidic, aromatic, aliphatic, or sulfur-…

Q: d) Cleavage by trypsin followed by gel-filtration chromatography gives the expected 6 products,…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…

A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…

Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…

A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…

Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…

A: Lambda DNA is a linear DNA extracted from E coli bacteriophage with 485052 base pairs (bp) At each…

Q: Some enzymes can catalyze a reaction involving NADH but cannot catalyze a reaction that uses NADPH.…

A: Since you have asked multiple questions we will solve the first question for you. If you want any…

Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…

A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…

Q: Mutual intermediates of catabolism of proteins, carbohydrates and lipids; their role in the…

A: Catabolism is the process of breaking down of complex compounds into simple molecules. The catabolic…

Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting lineoleic acid…

A: The fats are stored in eukaryotes as triglycerides that are broken down using the enzyme Lipase to…

Q: Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5'…

A: Transcription is the process of synthesis of mRNA using one of the strands of the DNA. During this,…

Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…

A: DNA extraction involves different steps which include, the breaking of cells to open and…

Q: 3. Explain why the structure of myoglobin makes it function well as an oxygen-storage protein…

A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…

Q: Provide the principle of each test used to detect the following substances. 17.    RNA: 18.…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: The ΔG°' for hydrolysis of ATP to ADP + Pi is -30.5 kJ/mol. -Calculate the equilibrium constant for…

A: Standard Gibbs free energy change (∆G0') is the change in Gibbs free energy at standard conditions.

Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…

A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…

Q: The drug troglitazone was used to treat diabetes but was withdrawn from the market when patients who…

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: Mach column (A) with Column (B)?* Waxes Serous gland Sphingolipids Fatty acid Beta oxidation Ketone…

A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…

Q: a) What is the Kd you measure for this interaction?

A: INTRODUCTION :   Actin - Actin is a family of globular multi-functional proteins which form…

Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…

A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…

Q: Which mechanisms are used by miRNAs to regulate expression? O Targeted degradation of mRNAs O…

A: Introduction: MicroRNAs (miRNAs) are non-coding endogenous single-stranded RNAs that play an…

Q: Name 2 prominent secondary structure of protein，lable out 3 differences between them.

A: Proteins are the polymers of amino acids. They have four different levels of structural…

Q: In ATP synthase, the ____ subunit is the site of ATP synthesis while the ____ subunit forms the…

A: Oxidation of glucose in the glycolysis and TCA cycle generates electrons carriers NADH and FADH2, As…

Q: Calculate 1/[S] and 1/V to complete the table. Use this data to draw a Lineweaver-Burke plot, with…

A: A Lineweaver-Burk plot represents the relationship between the reciprocal values of substrate…

Q: In the liver, what is the major regulation that dictates fate of pyruvate vs lactate? (This can tie…

A: Pyruvate that is produced as the end product of glycolytic pathway is converted into acetyl CoA…

Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…

A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…

Q: Explain IN DETAIL the reactions and processes of alcoholic and lactic acid fermentation.  Include…

A: The process of cellular respiration leads to catabolism of pyruvate after the glycolytic pathway.The…

Q: ESPIRATION - What is the purpose of cellular respiration? Where is cellular respiration performed…

A: Cellular respiration is the process of oxidizing nutrients like glucose to carbon dioxide and water.…

Q: Write the schematic diagram of lodine Value Determination as shown in the video by Amrita Vlab:

A: Simple fats are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of glycerol.…

Q: explain adenocarcinoma and carcinoid tumors in detail  Provide examples.

A: Cancer is deadly disease in which cells of body grow uncontrollably and spread to different parts of…

Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.

A: Catabolism is one is the steps of metabolism in which complex compounds are hydrolysed into simpler…

Q: DNA: How PCR works and why it's useful?

A: PCR is dependent on the ability of DNA polymerase to generate a new strand of DNA that is…

Q: What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 O…

A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…

Q: Which of the following is NOT true of a competitive inhibitor? A) Its effects can be overcome by…

A: Competitive inhibitor- It competes with the substrate for the active site of an enzyme, while the…

Q: 1 2 3 4 5 6 N Sample Lysate Name volume 8 Tilapia Cod Sole Perch Tilapia Cod Sole 2 μl Perch 10 με 2…

A: Protein sample: A non-branching sequence of amino acids joined together by a single peptide bond…

Q: Label the lipophilic and hydrophilic region of each lipid molecule below. H₂C CH₂ H₂C-Ne H₂C H₂C. HO…

A: Lipids are integral component of the cell membrane. Their structure consists of a backbone made up…

Q: What are the components of a nucleotide? Provide 1- or 2-sentence description of each component.

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…

A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Q: A Benedict's test: (+) Seliwanoff's test: (-) Bial's-Orcinol test: (+) TLC Profile rib gal gic A B 0…

A: Carbohydrates A biomolecule with the empirical formula Cm(H2O)n that consists of carbon (C),…

Q: You measure Protein A and Protein B to have a Kd of 10-8 M. At what concentration of Protein B will…

A: Here we have 2 proteins, 'A' and 'B' . The reversible equilibrium between these 2 proteins is shown…

Q: If the concentration of solutes in the fluid surrounding the cell is less than the cell's cytoplasm…

A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…

Q: Explain the cell response to FED, and then FASTED states, by glucose transporter (GLUT)-4. (answer…

A: Carbohydrate from food is converted to glucose by digestive enzymes which then enters the…

Q: Why carbon C-2 and C-5 are mark? why not just ona carbon is marked since just one carbon was marked…

A: Gluconeogenesis is the synthesis of glucose molecules from non-carbohydrate sources such as…

Q: The question of differentiation. How can a single cell the fertilized egg generate so many different…

A: Introduction Fertilization is a process by which male and female gametes combines to form zygote.…

Q: Two 0.9 mL aliquots of a serum are placed in two separate test tubes. These two test tubes are…

A: Method evaluation is a criteria by which we evaluate whether or not a new analytical technique meets…

Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…

A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…

Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?

A: Introduction A bioreactor is a vessel or manufactured device which gives biologically active…

Q: 3. Given the following peptide sequence, GSICDNCR, the estimated net charge at the given pH is: a)…

A: Peptides: Organic substances known as amino acids include both amino and carboxylic acid functional…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.