A nerve cell and a skin cell from the same person have Group of answer choices A. different gene expression B. different versions of genes C. same gene expression D. none of the above E. different genes
Q: a. When gene probes, fi ngerprinting, and sequencing make it possible for you to know about genetic…
A: a. When gene probes, fingerprinting, and sequencing make it possible for you to know about genetic…
Q: How had DNA Microarray Technology revolutionized the study of gene activity? a) gene expression in…
A: A DNA microarray (also known as a DNA chip or a biochip) is a collection of tiny DNA patches that…
Q: Explain how gene expression is relevant to your life. - How is it useful? - Why should anyone…
A: Gene expression is basically a process by which data from a gene is utilized in the combination of a…
Q: What do loss of function alleles tell us about normal gene function? Why would a researcher be…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What is the advantage of studying the mRNA present in a cell rather than the DNA? A. The mRNA is…
A: mRNA is just as important in the cell as DNA. Messenger ribonucleuc acid, or mRNA carries the…
Q: Mutation (a) can produce new alleles. (b) can be harmful, beneficial, or neutral. (c) is a change in…
A: The hereditary substances of all organisms are Nucleic acids. Deoxyribonucleic acid (DNA) is the…
Q: Some genes evolve more rapidly than others. But how can this be demonstrated?
A: With the sequencing of genomes of many species, the geneticists are giving a detailed picture of the…
Q: DNA, RNA and proteins were isolated, then combined and separated into 3 different samples. Each…
A: In the given question, we are given 4 different experiments which were performed by scientists in…
Q: Which of the following is a technique that can be used to determine the effect of a genotype on a…
A: Quantitative Trait Mapping is a process of locating genes that shows the genetic effects on…
Q: Is a mutation more likely to be lethal if it impacts early or late stages in development? Explain…
A: Mutation can be defined as the sudden change that happens in a genome that can be inheritable. It…
Q: Which of the following are types of segmentation genes? a. Gap genes b. Pair-rule genes c.…
A: A gene is the basic unit of heredity, physical and functional. Gens consist of DNA. Some genes act…
Q: For the expression of traits gene provide only the potentialily and the environment provides the…
A: The nature of the gene can be understood in terms of either dominant or recessive in nature. These…
Q: Which of the following statements is true?a. Not all inheritance patterns follow a strict…
A: The transmission of genetic material from parents to their offsprings is referred to as inheritance.…
Q: Gene expression can be viewed at which of the following levels?a. Molecular and cellular levelsb.…
A: Gene expression is a process by which genetic code is converted to functional protein or non-protein…
Q: An organism with a wild-type phenotype has a. the most common expression of a gene in a population.…
A: The wild-type phenotype is the most common manifestation of a gene in a population. Thus, an…
Q: The term epistasis is used to refer to a situation in which the expression of a gene is influenced…
A: Epistasis is a phenomenon in genetics in which the effect of a gene mutation is dependent on the…
Q: Comparative genomicsa. is the application of computer technologies to the study of thegenome.b. is…
A: Comparative genomic is the field of biological research in which the genomic features of different…
Q: A person’s blood type is the result of expression of a gene with three alleles. However, only 2…
A: The blood group is determined by the presence of specific antigen on the plasma membrane of red…
Q: Figure illustrates albinism in two different species. Describetwo other genetic disorders found in…
A: Genetics is the branch of biology that deals with the study of genes, their inheritance patterns,…
Q: a) "A particular DNA sequence" that codes for Hair colour is located in b) "chromosome 9". DNA…
A: Genetics is a branch of biology that studies genes, genetic diversity, heredity and variation in…
Q: Which of the following statements concerning genes are true? Select all that apply. A gene is a…
A: ANSWER;-option a is correct. Explain;- A gene is the basic physical and practical unit of…
Q: A geneticist interested in immune function induces random mutations in a number of specific genes in…
A: Genetics is a branch of biology which is concerned with the study of genetic variation, genes, and…
Q: Pedigree analysis is necessary when studying human inheritance patterns because . a. humans have…
A: Ans: The diagram or chart which represents the occurrence, as well as the appearance of phenotypes…
Q: Which of the following is the sequence in which the segmentation genes act? a. Segment-polarity…
A: Genes which are developed from zygotes are called zygotic genes. There are three types of zygotic…
Q: Which of the following is the definition of the term named Dominant trait? a.Refers to genes that…
A: Heredity deals with the inherited characters are the characters that passes on from one generation…
Q: ion d)DNA that provides instructions for building a protein e)DNA that provides the instructions…
A: Gene is physical and functional unit of heredity. DNA that provides instructions for building a…
Q: What happens to an organism (plant, animal, or microorganism) during genetic modification? A. Fewer…
A: Genetic engineering is a part of recombinant technology in which the gene is altered. A gene is a…
Q: Which statement explains the result of the process shown in Figure 12 This process generates RNA…
A: Transcription is the process of formation of RNA using DNA as a template and DNA dependent RNA…
Q: People with severe depression, mild depression, or no depression are included in GWAS research. Why…
A: A genome-wide association study (GWAS) is an approach used in genetics research to associate…
Q: Forward mutations A change a wild-type allele to a different allele. B changes and mutant…
A: The changes in the sequence of DNA due to mistakes during replication, UV light, or environmental…
Q: in inherited chan Alternate versions of genes (different alleles) account for This is why siblings…
A: Genes are the units of heredity. They are specific nucleotides that are responsible for phenotypic…
Q: You are examining the gene expression patterns of twins. Which of the following do you expect? Group…
A: In genetics apart from the genes, the environmental situation do play an important role in their…
Q: What contributes to obesity among humans today? a. eating more calorie dense foods b.…
A: Obesity is one of the health disorders where abnormal or excessive fat accumulation occurs. A body…
Q: why the negative control sample (from an unaffected individual) only produced one band. b.…
A: Huntington's Disease It is a rarer disorder where the brain cells or the neurons starts degenerating…
Q: What choice best descirbes how genes are used in different cell types in your body. An example of…
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: If a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a…
A: Mutation refers to the sudden changes that occur in the sequence of DNA’s (deoxyribonucleic acid)…
Q: In organisms with X and Y chromosomes, many more genes can be found on the X chromosome than on the…
A: Sex chromosomes are defined as the chromosomes responsible for determining whether the organism will…
Q: Which of the following is true of genomic imprinting? a. The sex of the parent that transmits an…
A: Gene is a specific nucleotide sequences in RNA or DNA. It is generally located on a chromosome. The…
Q: How can a polygenic trait be easily identified? a. There ae only two possible phenotypes for the…
A: Polygenic trait can be defined as a trait ;where more than one gene is involved in controlling the…
Q: You have been put in charge of developing a breed of domesticated dog that lives to be 40 years old…
A: There's a reason we call them man's best friend. We can learn so many things from a dog's behavior,…
Q: Melanin is a skin pigmentation that absorbs and dissipates broadband UV rays. Since UV radiation…
A: UVR is significant environmental factor that affects the function and survival of many cell types,…
Q: what is the linkage between the ct and s genes? A. 15.7 cM B. 32.6 cM C. 21.3 cM D.…
A: Genes that are sufficiently close together on a chromosome will tend to "stick together," and the…
Q: What is incomplete dominance? A) When one Allele produces the phenotypic expression. B) When two…
A: Allele is an alternative form of genes occupying corresponding position on homologous chromosome.A…
Q: Explain the relationship between a mutation, a protein, a trait, as well as dominance and…
A: Relationship between a mutation, a protein, a trait, as well as dominance and recessivity of an…
Q: A scientist cloned a sheep. Which of these statement is true about the cloned sheep? a. It lacks…
A: Cloning is an asexual reproductive method that can occur naturally or artificially. The term clone…
Q: Do you think gene therapy works better for a recessive disease or a dominant disease? Why (be…
A: Studies are conducted to treat dominantly inherited pathologies. Dominant diseases are very rare. By…
Q: In Labrador retrievers, two genes work together to determine coat colour.The first gene affects the…
A: Mendel states that the two alleles of a gene do not merge in any way while they are present together…
Q: In Labrador retrievers, two genes work together to determine coat colour.The first gene affects the…
A: Given: In Labrador retrievers, two genes work together to determine coat color. Description…
Q: By gene regulation, mechanisms that turn on certain genes while other genes remain turned off, cells…
A: According to the question, we have to mention that the statement " By gene regulation, mechanisms…
A nerve cell and a skin cell from the same person have
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What choice best descirbes how genes are used in different cell types in your body. An example of different cell types are muscle and brain cells. (level 2) All cells in the human body have the same genes and every cell uses every gene. All cells in the human body have the same genes but different cell types express (use) different genes. All cells have the same chromosomes but different cell types have different genes. coocific eate the cell in the middle In thic 6 stv MacBook Air DII 888 FS & % %23 8 9 з 4 5 R т Y U E G H K D C V command .. ** OOOMany human cancers result when a normal gene mutates and leads to uncontrolled growth (a tumor). Genesthat cause cancer when they mutate are called oncogenes. Chemotherapy is effective against many tumorsbecause it targets rapidly dividing cells and kills them.Unfortunately, chemotherapy has many side effects,such as hair loss or nausea, because it also kills many ofour normal cells that are rapidly dividing, such as thosein the hair follicles or stomach lining.Many scientists and large pharmaceutical companiesare excited about the prospects of exploiting theRNAi pathway to selectively inhibit oncogenes in lifethreatening tumors. Explain in very general terms howgene-silencing therapy might work to treat cancer andwhy this type of therapy would have fewer side effectsthan chemotherapyThe rectangles under each cell type shows 4 different genes. If the gene is expressed (used) in that type of cell the box is blue. If that gene is not expressed (used) in that type of cell the box is unfilled. Cogethe M o e ware ducton or y Cell type Red blood Muscle Pancreatic Gene type Housekeeping Hemoglobin. Insulin Myosin You don't really need to know what the different genes do but here is that info anyway: Housekeeping genes- genes that allow the cell to do basic functions like cellular respiration. Hemoglobin- A protein that carries oxygen molecules Insulin- A protein that tells cells to absorb glucose from the blood Myosin- A protein that forms muscle fibers. Using this information answer both parts" Red blood cells and muscle cells look very different and have different functions, Using the information in the diagram about the different genes explain why red blood blood cells and muscles cells could be so different even though they have identical chromosomes. tv MacBook Air…
- Epigenetic changes maya. be programmed during development.b. be caused by environmental changes.c. involve changes in the DNA sequence of a gene.d. be both a and b.The rectangles under each cell type shows 4 different genes. If the gene is expressed (used) in that type of cell the box is blue. If that gene is not expressed (used) in that type of cell the box is unfilled. Cyghe Mr Compan n wadproduton ory Cell type Red blood Muscle Pancreatic Gene type Housekeeping Hemoglobin Insulin Myosin You don't really need to know what the different genes do but here is that info anyway: Housekeeping genes- genes that allow the cell to do basic functions like cellular respiration. Hemoglobin- A protein that carries oxygen molecules Insulin- A protein that tells cells to absorb glucose from the blood Myosin- A protein that forms muscle fibers. Compare the chromosomes and genes found in the red blood cells and the muscle cells? Are all 4 genes found .on the chromosomes of both types of cells? Note- this question is not asking if the genes are being expressed (just if they are present). etv 26 МacBook Air DII 80 888 F10 F7 F6 F4 F3 & $ 3 4 9. 7 W E R Y G H J K…CD,cd 'In a cross between AabbXX° and AaBbXY A Ccontrols earwat where wet earwax is dominant to dry eauwax. B controis PTC tasie where tasting is dominoNO to non-tasting . The C gene controls covor Uision where Coor uISun 16 dominunt to color blindress. The D gene ontrols jysraphun producaon, me gene that is disrupted in muscular dystrophy (DMD). indivi duals who nave wo copies of me recessive d auele or are nemizyguus for he recessive d aleve nave muscular dyohng ) when two parents have a chld what is the Qvobalbility the child has wet earwax, is abte to taste PTC, sce color, and has muscular dystrophy? 2) wnen two Quwents have fue children, what is the probability that four oe them Can taste pTC, pne is a non-taster for PTC, and all fve of mem have wet earwax ?
- Every cell contains all of the DNA for an organism. What controls when and how specific genes are expressed? Genes are not controlled, all genes are expressed all the time Gene expression is controlled by sequences in the DNA Gene expression is controlled by proteins Gene expression can be controlled by proteins and sequences in the DNA O 000. Neurofibromas are tumors of the skin that can arisewhen a skin cell that is originally NF1+/ NF1− losesthe NF1+ allele. This wild-type allele encodes a functional protein (called a tumor suppressor), while theNF1− allele encodes a nonfunctional protein.A patient of genotype NF1+ / NF1− has 20 independent tumors in different areas of the skin. Samplesare taken of normal, noncancerous cells from thispatient, as well as of cells from each of the 20 tumors.Extracts of these samples are analyzed by a techniquecalled gel electrophoresis that can detect variantforms of four different proteins (A, B, C, and D) allencoded by genes that lie on the same autosome asNF1. Each protein has a slow (S) and a fast (F) formthat are encoded by different alleles (for example, ASand AF). In the extract of normal tissue, slow and fastvariants of all four proteins are found. In the extractsof the tumors, 12 had only the fast variants of proteinsA and D but both the fast and slow variants of proteins B and…1. Match each of the terms in the left column to the bestfitting phrase from the right column.a. epistatic interaction 1. divide the body into identical units(segments)b. regulative 2. initiated by binding of ligand todetermination receptorc. modifier screen 3. individuals with cells of more thanone genotyped. RNAi 4. the fate of early embryonic cells canbe altered by the environmente. ectopic expression 5. assign identity to body segmentsf. homeodomain 6. substance whose concentrationdetermines cell fatesg. green fluorescent 7. suppression of gene expression byprotein double-stranded RNAh. genetic mosaics 8. method for identifying pleiotropicgenesi. segmentation genes 9. a DNA-binding motif found incertain transcription factorsj. homeotic genes 10. encode proteins that accumulate inunfertilized eggs and are needed forembryo developmentk. morphogen 11. double mutant has phenotype of oneof the two mutantsl. maternal effect 12. a gene is turned on in an inappropriategenes tissue or at…
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).True or false? Gene expression patterns can be inherited.Differential gene expression describes how... (Choose the answer the best illustrates the definition of differential gene expression.) O each cell in your body expresses only a subset of its genes. O every cell in your body expresses all its genes, but at different times. every cell in your body expresses only a subset of its genes, but all these cells express the same subset of genes. different cells in your body express different subsets of genes.
