A mistake in DNA replication, in which the wrong base is placed in the growing DNA strand, can have profound effects on the descendents of any cells that carry the mistake.In the following strand, the A has been changed to a G. Draw the DNA molecules that result from replication of the altered strands. Original Strand T A G C G T T Mutated Strand T G G C G T T A T C G C A A A T C G C A A

A mistake in DNA replication, in which the wrong base is placed in the growing DNA strand, can have profound effects on the descendents of any cells that carry the mistake.In the following strand, the A has been changed to a G. Draw the DNA molecules that result from replication of the altered strands. Original Strand T A G C G T T Mutated Strand T G G C G T T A T C G C A A A T C G C A A

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Similar questions

The phrase 5to3 refers to the _________ . a. timing of DNA replication b. directionality of DNA synthesis c. number of phosphate groups
Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ________. a. the nucleotide b. DNA polymerase c. phosphate-group transfers from ATP
During DNA replication, a template strand is used to synthesize a new "daughter" strand of DNA. Below is a sequence of a short segment of DNA. Provide the base sequence in the complementary strand and label all ends. 5’ A A T C G T A A G C T 3’
Choose the lettee of the correct answer: The following is the sequence on one of a DNA molecule A A T G C C A G T G G T 1. If this strand is replicated, which of the following is the complementary strand that is produces? A. T C G T C C G T C T A G B. A G C A G G C A G G G T C. T T A C G G T C A C C A D. U C G U C C U C U A G A 2. If transcribed into an mRNA what would be the resulting strand?A. U U A C G G U C A C C A B. A G C A G G A G A T C C. A G C A G G C A G A U G D. T C G T C C G T C T A G 3. During translation, the tRNA sequence of nucleotidea arranged linearly is ___ A. T C C T C C C T C T A G B. A A U G C C A G U G G U C. A G C A G G C A G A U O D. U C G U C C G U C U A G Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code for a specific amino acid. The table shows the mRNA codon for each amino acid. Use the genetic code table to answer the questions. 4. The…
Replication is the process of producing an exact copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA is known as: O initiation O elongation termination replication fork
Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes the formation of an cross-link, through the formation of a group, which impact DNA replication and transcription. HN- Thymine HN- UV-B HN- Thymine HN
In the figure, which ketter represents DNA polymerase 1 D AA BB C.C DD EE
Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'- A A C G G T C C A G T C C A A G T T A C G-3'
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
Give the mRNA nad amino acid sequence from the given DNA strand.3' G G A T T A T C G G A T T G C C G T A G 5'5' C C T A A T A G C C T A A C G G C A T C 3'