8. Explain the role of post-translational modifications of protein molecules: the formation of disulfide bridges, hydrolysis of peptide bonds under the action of specific proteases, glycosylation, phosphorylation / dephosphorylation, hydroxylation, acylation of the terminal amino transformation of the terminal carboxyl group into an amide one group and
Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…
A: The figure shows the process of translation.Translation is the process in which ribosomes in the…
Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…
A: Alteration of genetic information shown below is an example of Deletion Mutation. In the given…
Q: The peptidyltransferase reaction begins with the hydrolysis or breaking of the bond between the…
A: The translation is the process in which the genetic code carried by mRNA is decoded to produce the…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: 6. Please describe the events that may result in a mature protein not having methionine as the…
A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…
Q: 9. Describe the importance of DNA in determining the structure of a particular protein.
A: The DNA sequence (gene) is very important for the protein sequence, structure and function.…
Q: 4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a…
A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that contains coded genetic…
Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…
A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: 4 What Kinds of Covalent Modification Regulate the Activity ofEnzymes?
A: Covalent modification of enzyme is carried out by the addition of some specific chemical groups at…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…
A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.
Q: 10. Which of the following is a purely ketogenic amino acid? A. Tyrosine B. Leucine
A: Ketogenic amino acids are the amino acids that can be converted directly to acetyl CoA, which is…
Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…
A: Sickle cell anaemia is an autosomal recessive disorder.
Q: 16) Which of the following occurs when proteins fold? O The protein adopts Its lowest energy state…
A: Protein folding means the conversion of a linear polypeptide chain into a definite three-dimensional…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…
A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…
Q: 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…
Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…
A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…
Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…
A: Transcription is defined as the synthesis of mature mRNA from antisense DNA template. Translation…
Q: 1.11 Which post-translational modification prepares proteins for degradation? O Ubiquitinylation O…
A: Post translation modification also called PTM's. These are the few modifications which takes place…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: The strength of ligand-protein binding is a property of the binding site called --------------
A: Protein has region to which ligand binds, this region is called binding site or active site . Amino…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…
Q: 10. Which of the following is not involved in the biosynthesis of a protein molecule? 1. Codon 2.…
A: Cellular organisms contain DNA in each and every cell which acts like a genetic information…
Q: Post-translational modifications of proteins include all the following EXCEPT a) alteration to the…
A: Translation is a process in which the RNA is translated into protein.Post translational modification…
Q: 6. Which of the following amino acid does not include post-translational modification? a.…
A: Post translational modification is a covalent and enzymatic modification which occurs after the…
Q: 10. Which of the following statements is FALSE about proteins? A) The sequence of the atoms in the…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: 17 Select all of the true statements regarding biomolecules and their building block monomers. To be…
A: Nucleotides are building blocks of nucleic acids. So 1st option is incorrect. Fatty acid and…
Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…
A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…
Q: What determines the affinity of a glycan for a GBP?
A: Glycans and glycan-binding protein interaction are a major way of understanding the structure of…
Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…
A: The given sequence can be read by combining sets of three nucleotides per amino acids.
Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation
A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…
Q: 10. Messenger RNA often encodes more that one biological activity. These activities can then be…
A: Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition
A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…
Q: What are congenital disorders of glycosylation (CDGs)?
A: Congenital disorders of glycosylation is a broad term used for rare genetic and metabolic disorders…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: Protein molecules are those molecules that are made up of chains amino acids in a specific order.…
Q: 10. Explain the difference at the molecular level in how temperature and urea denature a protein.
A: The three dimensional structure of a protein is held together by noncovalent interactions like…
Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…
A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…
Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…
A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…
Q: 12. Identify the nucleotide from the following list of nucleic acid components. A. adenosine…
A: There are many biomolecules present in the human body. Some of the biomolecules are monomers that…
Q: 1. Look up the mutation associated with Hemoglobin Hammersmith. A.) Identify the amino acid changed…
A: Hemoglobin is a protein found in the RBCs which is responsible for the transport of oxygen from…
Q: The role of mRNA in protein synthesis is that it ____.
A: Proteins synthesis is the most important essential and significant metabolic activity of the living…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…
A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…
Step by step
Solved in 3 steps
- Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В сWhich of the choices are types of posttranslational modifications a newly synthesized protein may undergo? Select all the choices that apply. changes to hydrogen bonding capabilities formation of an amide bond between Cys and an isoprenyl group removal of prosthetic groups removal of the thiol group from a Cys residue modulation of charges on amino acids proteolytic cleavage covalent attachment of oligosaccharides to Asn, Thr, or Ser9. List down the different fragments that would result if dynorphin were cleaved by trypsin. 10. How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. 11. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin.
- Protease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of metalloprotease begins with generating a nucleophile that attacks the peptide bond that attacks the peptide carbonyl group. O Macmillan Learning On the basis of the information provided in the figure, show the next step in the mechanism for peptide-bond cleavage by a metalloprotease. Metalloproteases H R₁ HN Zn Enz 2+ R₂ Draw curved arrows on the pre-drawn structures to show the metalloprotease mechanism. If you need to reset the structures, click More followed by Reset Drawing. Select Draw Templates Groups More B - H Enz H H с R1 | : HN O | Zn 2+ B R2 N Zn Erase2. Compare and contrast the biological roles of the following amino acids the following pairs of amino acids. Once you have documented these role state which member of the pair is most important and why (1-2 sentences) Pair #1 Ketogenic, glucogenic or both Prevalence in peptides and proteins Role in biosynthesis Role in homeostasis (e.g. ammonia) Aspartic acid Glutamic acid Important in which pathways Pair #2 Arginine Histidine Ketogenic, glucogenic or both Prevalence in peptides and proteins Role in biosynthesis Role in homeostasis (e.g. ammonia) Pair #3 Ketogenic, glucogenic or both Prevalence in peptides and proteins Role in biosynthesis Role in homeostasis (e.g. ammonia) Important in which pathways Tyrosine PhenylalanineWhat general structural feature is shared by proteins that specifically form homodimers (but not homotrimers, homoteramers etc)? Only one answer is correct. the surface consists of hydrophilic alpha-helix. the surface is highly modified by post-translational modification. the surface is permanently bound by chaperones. the surface is unstructured. the surface, or part of it, is self-complementary.
- Briefly describe each of the following possible posttranslational protein modifications. Give an example of each. Cross-linkage glycosylation and phosphorylation cleavage assembly into polymeric proteins (> 1 polypeptide)Please ASAP. Thank you. How does the mutation change/affect the structure of the Hb heterotetramer (ie how is quaternary protein structure affected)?Translate the given amino acid sequence into one-letter code. Glu-Leu-Val-Ile-Ser-Ile-Ser-Leu-Ile-Val-Ile-Asn-Gly-Ile-Asn-Ala-Thr-Leu-Ala-Asn-Thr-Ala Translated code: X Incorrect
- 6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group of serine, threonine, or tyrosine residues. The R-group for phosphoserine is shown at right. A) The image below is an Isoelectric focusing strip that shows the unphosphorylated protein-of-interest (in blue). To which side of the unphosphorylated protein would you expect to see the phosphorylated protein? (Draw an arrow to indicate direction). Briefly justify your answer. un-phosphorylatable: Low pH Justify: B) To study the effects of phosphorylation, researchers often mutate a Ser/Thr to appear as though it is always phosphorylated or never phosphorylated at a particular site. What amino acid substitution should you use to preserve similar dimensions as Ser (or Thr) but make the side chain appear to be: constitutively (always) phosphorylated: Justify: Ser or Thr → O O=P-O O I CH₂ Ser or Thr➜ Phosphoserine High pHChanging one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missenseWhich of the choices are types of posttranslational modifications a newly synth choices that apply. changes to hydrogen bonding capabilities formation of an amide bond between Cys and an isoprenyl group removal of prosthetic groups removal of the thiol group from a Cys residue modulation of charges on amino acids proteolytic cleavage covalent attachment of oligosaccharides to Asn, Thr, or Ser Incorrect < Feedback Macmillan Learning There are four correct choices. Proteolysis (proteolytic cleavage) is the partial or complete breakdown of a protein. Keep in mind that amino acids are linked together during protein synthesis. Recall that some proteins are posttranslationally modified to form glycoproteins. Consider the structure, or components of, a glycoprotein. In addition, think about how the methylation of a protein affects intramolecular forces.