7. The diagram below represents a portion of a deoxyribonucleic acid. 10 sbri odt Which sequence of base pairs along the bottom complemer the base pairs labeled on the top side of the nucleic acid? A ATGC B UACG OTACG D GCAU E

Q: #1 Structure "B" in the diagram above is... Select one: COA a sugar group (deoxyricose) OB. a…

A: A polymer made of two chains of polynucleotide wrapped around one another to create a double helix…

Q: 3. Use the 15 molecules illustrated below to answer the following question. Nucleotides consist of a…

A: The basic structure of nucleotides is shown below:

Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: The nucleic acids are known as polynucleotides. Monomeric units of nucleic acids are called…

Q: red 3.00 ion The nucleic acid from a particular species of bacteriophage is analyzed and found to…

A: The Chargraff rule states that purines and pyrimidines must be present in equal ratios in a DNA…

Q: 11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two…

A: In an alpha helix, each amino acid residue forms hydrogen bonds with the amino acid located three…

Q: Draw the chemical structure of the three components of a nucleotide and then link the three…

A: Nucleotides are monomeric units of the genetically important biopolymers deoxyribonucleic acid and…

Q: 1. H₂N a. Draw the peptide sequence, including stereochemistry (wedges and dashes) for Glu-Cys- Gly.…

A: Stereochemistry refers to the illustration of the arrangement or connectivity of atoms to a chiral…

Q: The codon CGG codes for which amino acid in the genetic code? Select one alternative: Serine O…

A: Gene is the basic unit of heredity. The process by which mRNA is produced from DNA is called…

Q: 5. In a portion of polypeptide shown below, which bond is described by o O0 0? А. 1 В. 2 С.3 D. 4 E.…

A: A polypeptide chain is a linear chain of many amino acids.

Q: 12. Draw the structure of a reverse Hoogsteen A•U base pair with two hydrogen bonds. Draw hydrogen…

A: 12. Reverse Hoogsteen base pairs:  In a reverse Hoogsteen base pair, one of the bases is rotated 180…

Q: DOUBLE-STRANDED SUGAR" PHOSPHATE A. B USUALLY SINGLE-STRANDED SUGAR PHOSPHATE * DEOXYRIBOSE *RIBOSE…

A: Nucleic acid are biological macromolecules that consists of genetic material . It is present in most…

Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…

A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…

Q: 3. Below is the structure of a nucleotide triphosphate. of of of O ATP R-O- R-O O R-O O O O O +|| O…

A: Nucleotides are organic molecules that form the basic building blocks of nucleic acids (DNA and…

Q: 3. Use the 15 molecules illustrated below to answer the following question. Nucleotides consist of a…

A: DNA and RNA are the nucleic acids used as genetic carriers to transfer information from one…

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: 10. Your instructor has given you three test tubes, each containing a different unknown solution.…

A: There are various types of biomolecules present in living organisms. Some are simple whereas others…

Q: 3. Please use curved arrows to draw the protonated form (the conjugate acid) of each Lewis base…

A: The protonated form of each Lewis acid is:a)b)

Q: 1) What is wrong with the nucleoside shown below? Focus on the sugar portion. What sugar should be…

A: We have two types of nucleic acids namely:DNA or Deoxyribonucleic acid andRNA or Ribonucleic acid…

Q: 4. The base content of a particular DNA molecule is 24% G. What is the percentage of the following…

A: DNA is a double helical structure composed of units called nucleotides. Each nucleotide is composed…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: Amino Acid 2 = V + Y = 11 Name of amino acid 2: Lysine Draw L-amino acid 2 at pH = X = 2 Calculate…

A: Answer 2: The 11 amino acid is called nonsense amino acid. So, the answer is Lysine. The structure…

Q: What is the Amino Acid Sequence of 3'-AUG GUA CUC UUA ACA CCA GUG GAA AAA-5'

A: Proteins are polymers made of amino acids. The cellular process by which proteins are synthesized by…

Q: Name the first complementary base from the 5' direction. 2.Give the ABBREVIATED NAME of the…

A: DNA is made up of nucleotides. Each nucleotide is made up of a deoxyribose sugar, phosphate group…

Q: . the position that distinguishes between DNA and RNA is 2. the carbon that the phosphate group…

A: 1. The position that distinguishes between DNA and RNA is A sugar called ribose is found in RNA,…

Q: 9. For the DNA segment with nucleotide sequence 5' TATCGC 3', how many hydrogen bonds in total hold…

A: Enantiomers are chiral molecules that are mirror images of one another. The molecules are…

Q: The 3' end of a nucleotide has a free OH group on the 3' carbon atom. O True O False

A: A nucleotide is a biomolecular structure that acts as a polymer for the formation of DNA or RNA…

Q: How do I determine an amino acid sequence from RNA? I know you start at AUG which is methionine…

A: To determine an amino acid sequence from RNA, the translation machinery makes use of the genetic…

Q: 1. Look at the following diagram of a nucleotide, below, and circle and label all three components:…

A: A nucleotide is composed of 3 components;A pentose sugarA nitrogenous baseOne or more phosphate…

Q: This figure represents which nitrogenous base? Hint: pairs with C   Question 42 options:   adenine…

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA is composed of…

Q: Which statement is FALSE regarding when a pyrimidire base is incorporated into a deoxynucleoside?…

A: DNA ( deoxyribonucleic acid) is a type of nucleic acid.  Nucleic acids are present inside the…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…

Q: 13. Draw the structure of a G•U base pair with two hydrogen bonds. Draw hydrogen bonds as dashed…

A: In the below drawn diagram, R signifies ribose sugar. Red discontinued line denotes 2 hydrogen…

Q: AŅH2 B H. E но-р-о N. o+c D OH OH

A: Nucleotides are referred to as the building blocks of nucleic acids. Each nucleotide is made up of a…

Q: 1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the…

A: Nucleotides are phosphoric acid esters of nucleosides (pentose sugar containing a nitrogenous base).…

Q: nbonucleotide in automated RNA synthesis. Point to the functional groups

A: In automated RNA synthesis, a ribo nucleotide is used. When we look at epinephrine signalling, we…

Q: N- NH O=P-OCH, `NH, HN он 'N. O= P- OCH, NH, ОН 'N N. O= P-OCH, OH ОН

A: There are mainly two types of nucleic acids:- deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: What structure is shown in the diagram?

A: Option C: RNA

Q: 8. Provide the structure of guanine, a heterocyclic base found in DNA. 9. Provide the structure of…

A: Nucleic acids are biomolecules composed of nucleotides. Nucleotides are composed of a pentose sugar…

Q: If all you know about a single stranded nucleic acid is that it has 30% Uracil, then which of the…

A: DNA or deoxyribonucleic acid is the double stranded helical structure and the genetic material in…

Q: 14. Draw the structure of a U•A•U base triple. Draw hydrogen bonds as dashed lines, and draw…

A: a pairing of complementary bases in a double-stranded nucleic acid molecule, comprised of a purine…

Q: Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end.…

A: Deoxyribonucleotides are the smallest units present in DNA. DNA is also known as deoxyribonucleic…

Q: Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that…

A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…

A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…