7. Number the following from the point the filtration (with a number 1) to the point it drains into the renal sinus in renal pelvis (with a number 12). Sequence # Sequence # 12 Papillary duct Glomerulus Minor Calyx Capsular space Nephron loop (ascending) Collecting duct Renal sinus in renal pelvis Loop of Henle Distal convoluted tubule Proximal convoluted tubule Major Calyx Nephron loop (descending)

what deficiency/mutation in the gene causes acute liver failure due to autoimmune hepatitis

tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letter

I need help putting these steps in order please  Thank you!