579 to 582 (YIYV) in the PDGF-Beta receptor were eptor to give PDGF (YLIP) and EGF (YIYV) (Select all

Q: A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction of…

A: DNA stands for Deoxyribonucleic acid which is a long double helical tread-like structure. A single…

Q: Which is made in the reproductive organs?

A: Reproduction is the process by which new individual organisms are produced. Organisms of the same…

Q: What factors must be present for allopatric speciation to occur?

A: speciation is the process of evolution in which new, different species are formed. A single…

Q: How can lifestyle changes affect chronic diseases management? In what way does early diagnosis help…

A: The term lifestyle can be referred to as a specific way of living that is utilized by the human…

Q: A gene present on both the X and Y chromosome in homo sapians is called ANT 3. There is a mutant…

A: Inheritance is the process of transmission of the genes from parent to offspring. It is the passing…

Q: 2 things are wrong with the paragraph below. Write the word or words that would need to be changed…

A: Fermentation pathways are anaerobic pathways. These pathways are either present in anaerobic…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenytic tree represent the relationship between different organisms and also gives us idea…

Q: Explain the metabolic processes in cyanobacteria (glycolysis, krebs cycle, electron transport chain…

A: Cyanobacteria are bacteria that are able to photosynthesize. They are an important group of…

Q: The nr2f5 gene is transcribed into mRNA in both neurons and glia. The microRNA miR-5xb has partial…

A: Explanation: Both neurons and glia are capable of producing mRNA from the nr2f5 gene once it has…

Q: Which of the following would be the least desirable model species to learn how proteasomes govern…

A: Proteosomes are Special cell organelles which along with ubiquitin form a complex that is involved…

Q: Anatomically, the motor endplate potential is characterized by synaptic boutons active zones O…

A: Motor endplate-The specialized postsynaptic area of a muscle cell(myocyte). The motor endplate lies…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: Write the species for the following:

A: The species is a taxonomic rank in biological classification that includes all the organisms which…

Q: 2. Your supervisor instructs you to prepare chemically competent cells for heat shock transformation…

A: Every day, genetic engineering's advancement, comprehension, and development dive deeper, and with…

Q: Which events or functions in the respiratory system are easily measured by the ergonomist and can be…

A: Ergonomists make sure that the layouts of machines, systems, and buildings offer the greatest…

Q: Which resulting population has more genetic diversity?

A: Evolution is the process of change in traits or characteristics of a population over many…

Q: Compare/contrast extracellular matrix with basal lamina / basement membrane• What functions do they…

A: A tissue is a collection of nearby cells that are arranged to carry out one or more particular jobs.…

Q: You accidentally used safranin as the primary stain and malachite green as the counter stain during…

A: Note: Since you have posted multiple questions so we will be solving the first one for you. As per…

Q: 8. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…

A: A buffer system is important for a living thing as it helps to maintain a constant chemical internal…

Q: If you looked at H&E staining of a fungal-infected mouse tongue vs a non-infected mouse tongue,…

A: H& E stands for Hematoxylin and Eosin stain.This stain is used to observe various cellular…

Q: Proteasome inhibition might lead to an immediate ________ Select one: a. increase in cysteines b.…

A: Proteasome works in conjunction with ubiquitin. Proteasomes are found in the cytosol, both free and…

Q: How do microtubules act as a cytoskeleton? Are there times when they are particularly abundant?

A: A intricate web of protein filaments called the cytoskeleton is found in the cytoplasm of cells. It…

Q: Calculate the total number of bacteria in your yogurt container three times (in duplicate). Begin by…

A: Colony forming unit:  A colony-forming unit is used to determine the number of viable microbial…

Q: Transcribe the DNA into mRNA.  Sequence A…

A: The process of synthesis of messenger RNA with the help of DNA template strand is called…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: A trait is a characteristic feature that is unique to particular individual . Each trait is…

Q: List the phylum for the species, and assign the following structures to the correct phylum and…

A: We are allowed to do upto three sub part of a question.  Please repost the undone questions again.…

Q: Which of the following helped to lay the groundwork for understanding the record of historical…

A: The Earth was created by deposition from the solar nebula approximately 4.54 billion years ago,…

Q: If a goose with genotype Aa had migrated instead of the goose with genotype aa, would the scenario…

A: The movement of genes into or out of a population is referred to as gene flow. Such movement may…

Q: If the DNA was replicated using the dispersive model, what would you have expected to observe in the…

A: 3 theories for DNA replication Conservative: According to this theory, the parent molecule is re…

Q: Describe the 4 different ways that antibodies interact with pathogens to cause immunity.

A: Introduction The immune system is the body's defense system against infection caused by external…

Q: explain why the cell membrane must be partially permeable

A: Introduction In biology, a cell is a fundamental membrane-bound entity that houses the building…

Q: You are in a hurry to test a bacterial culture for spore production. You grow the culture or 12…

A: Endospore staining is a procedure used to observe bacterial endospores and differentiate them from…

Q: What is the role of dictyosomes in cell metabolism? What is their forming face? Their maturing face?…

A: Introduction :- In animal cells, the Golgi apparatus appears as a single compact or loose complex…

Q: polytomy of three taxa indicates three descendants evolved from their immediate common ancestor.…

A: Common ancestor is the organism through which descendants arise. All the descendants evolved from…

Q: In a population of 50 hamsters, 60 of the alleles code for brown fur and 40 alleles code for black…

A: If the allele and genotype frequencies remain same generation after generation then we can say that…

Q: 2. List the 4 biologically importance molecules (carbohydrates/lipids/proteins/nucleic acids) and…

A: Introduction :  Biomolecules are defined as the organic molecules present in a living cell which…

Q: The endplate potential is produced by ) too spread Na* channels simultaneous flow of Na* and K ions…

A: End plate potentials (EPPs) can be explained as the voltages which cause depolarization of the…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, shown on the…

A: Introduction :  Any alteration to DNA is referred to as a mutation. Any genetic and heritable…

Q: ems Be sure to show your work. Zookeeper hypothesizes that changing the intensity of the light in…

A: A hypothesis is simply a suggestion. A hypothesis to be tested. It is still an open question, and we…

Q: Questions:   a) what nerve will cause the palsy and why?   b) what question would you ask after…

A: Given information  The patient complains of having a headache and dropping of facial muscles.…

Q: What is the primary structure of a protein?  Describe how the primary structure of proteins is used…

A: A protein is a naturally occurring, extremely complex substance made up of amino acid residues…

Q: Why is it important for the sperm in internally fertilizing animals to undergo acrosome reaction at…

A: The fusion of male and female gametes resulting in the formation of deployed zygote. It ultimately…

Q: Which of the following statements is TRUE?     RNA codes for the production of protein.…

A: Nucleic acids These biomolecules constitutes chain of nucleotides. DNA and RNA are nucleic acids,…

Q: The mathematical shape of the earth can be made as: a. Flat b. Almost any shape such as spheroid…

A: Introduction :  Earth is an oblate spheroid. This means it is spherical in shape, but not perfectly…

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: In fruit flies, red eye color (R) is dominant over brown eye color (r). Two red-eyed fruit flies…

A: The offspring of two parents can be different from both parents as new allelic combinations can be…

Q: what does Priming Perspectives and Amplifying Advancements in genescape means

A: The question is posted in biology, I am assuming the question is about relational database…

Q: There are two ways in which rearrangement of domain- encoding gene segments can result in novel…

A: Introduction Prokaryotes: These are the organisms which have characteristic nucleoid rather than…

Q: Which exposure pathway has the fastest uptake in the human body?

A: There are various types of exposure routes by which agents can enter inside the human body. Some of…

Q: Why do water-dwelling animals have thicker bones than land-dwelling animals?

A: Bones are the organs of support and form the part of skeletal system. These maintain the body shape…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.