5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b. 3' AATА 5' с. 3' САСА 5' d. 3' CAAC 5'
Q: Kappa- and Iota- carrageenans contain 3,6-anhydro-a-D-galactopyranosyl residues. True False
A: Carrageenans are a family of hydrocolloidsh used for thickening, stabilising, and gelling solutions…
Q: Principle involved in the isolation of gluten * (Please choose one correct answer only) A.…
A: The protein component of wheat flour is called Gluten. This basic component gives elasticity and…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: Which of the following contain a correct first statement and an incorrect second statement?…
A: G proteins consist of the alpha, beta and gamma receptors for activating the cell signaling…
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Match the following descriptions to the given choices…
A: Vitamin - The organic molecule and an essential micronutrient which is required by any organism in…
Q: Discuss about enzymes: function, definition, and examples.
A: At high temperatures, most of the enzymes denature and unfold similarly low temperatures…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: what is the chemistry of nucleosides?
A: Nucleosides are nothing but glycosamines whose analogues are used as anti cancer agents or antiviral…
Q: 4) Complete hydrogenation of TAG (Y) above would yield a TAG of what fatty acid composition?…
A: In the given table, fatty acid composition of three Tri-acyl Glycerol is given: TAG(X) =…
Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…
A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: As given in the question, the concentration of each reactant, i.e., Pyruvate and NADH, and products,…
Q: Now let us look at a real amino acid, alanine. Fill in the chart below for each ionizable group. You…
A: Amino acids are the building block of proteins. Amino acids are consisted of carboxyl group, amine…
Q: What are examples of enzymes?
A: Enzymes are nothing but Proteins that help us in our metabolic pathways to increase the rate of…
Q: Draw the structure of alpha-ketoglutarate that is generated in a reaction catalyzed by glutamate…
A: Glutamate dehydrogenase (GDH) catalyzes the conversion of glutamate into α-ketoglutarate. The enzyme…
Q: Proteins are compounds composed of many _________ linked together
A: The protein which is most important constituent for every living organisms. The term protein firstly…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…
A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…
Q: Match lipid structures in column A with its lipid type in column B
A: Lipids are the group of organic components having oily or greasy consistency. Lipids are a group of…
Q: Explanations are not needed. Direct answers are enough. II. True or False a. An effort is…
A: The protein molecules after their folding have exposed patches of charged amino acids on their…
Q: What is the predominant attractive force that stabilizes the formation of secondary structure in…
A: The levels of structural organization of a protein are its primary structure, secondary structure,…
Q: Eukaryotic polymerases have the same number of subunits as prokaryotic ones. True False
A: The process of creating an RNA copy of a gene sequence is known as transcription. The copy is known…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC…
A: Polypeptides are composed of amino acids linked to each other via peptide bonds. The peptide bond…
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…
A: Signaling is the process of communication between the cells, and between the cells and the…
Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO…
A: The determination of primary structure of a protein is crucial since the sequence of the protein…
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: AP is a 35-yr old male presents with hypertension. His medications were known to work by inhibiting…
A: Any of several naturally occurring amines that act as neurotransmitters and hormones in the body is…
Q: lood group A has A antigen on the red blood cells with anti-A antibodies in the plasma. O True O…
A: Introduction: The ABO blood group system is the most common blood type system in human blood…
Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: -Inhibitor +Inhibitor [S] (mM) Vο&νβσπ: (μmol/sec). Vο&νβσπ:&νβσπ: (μmollsec) 0.0001 33 17 0.0005 71…
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: Which of the following contain statements that are both correct? Aspartame triggers the…
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…
Q: Which of the following is the CORRECT relationship?
A: Phosphatidylinositol 4, 5 bisphosphate is known as PIP2 that is a component of cell membrane -…
Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. 1. D-…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient…
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid.…
Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…
Q: What is the biological importance of carbon, nitrogrn and phosphorus?
A: Biomolecules are organic substances, which are majorly composed of carbon. Nitrogen and phosphorous…
Q: 1. A protein has a tertiary structure formed by interactions between the side chains of the…
A: The tertiary structure of a protein is stabilized by noncovalent interactions like hydrogen bonding,…
Q: Lys and Arg Glu and Lys Pro and Asp Among these amino acid combinations listed above, only the…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. All…
Q: The enzyme is considered to be alan* COO COO H-C-OH Phosphoglyceromutase H-C-0- ČHO-P ČH,OH…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: IV. Effect of Enzyme concentration Test Tube Concentration of Observations enzymes (mL) 1 ml 2 ml 3…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Choose two amino acid and explain the metabolism.
A: Introduction: Amino acids are molecules that contain an amine and carboxylic group with side-chain…
Q: B. Number of milligrams of KOH required to neutralize fatty acid present in 1 g of fat is called. A.…
A: A group of organic compounds includes lipids that are insoluble or poorly soluble in water.…
Q: The pH vs charge graph for a triprotic amino acid is shown below. Please answer the following…
A: An amino acid with the ability to donate 3 protons (3 H+) is called a triprotic amino acid. The 3…
Q: What name is given to the predominant secondary structure found in silk?
A: Proteins exhibit 4 levels of structural organisation. They are primary structure, secondary…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Step by step
Solved in 5 steps
- 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?6. Using the concept of complementary base pairing, write the complementary DNA strands, with their 5' and 3' ends labeled, for each of the following DNA base sequences. a. 5' AGCTAT 3' b. 5' TTACCG 3' c. 3' GCATAA 5' d. AACTGGWhat is the complementary DNA for the following: 5' ATG CCA GCT CAT 3' A. 5'ATG CCA GCT CAT 3' B. 5'TAC GGA CTA TAC3' C. 3'TAC GGA CGA GTA5' D. 3' ATG CCA GCT CAT5'
- 1. Are each of the following mutations silent, missense, nonsense, or frameshift mutations, why? The original coding DNA strand is: 5’-ATGGGACTAGATACC-3’. 2. 5’-ATGGGTCTAGATACC-3’ 3. 5’-ATGGGACTAAGATACC-3’ 4. 5’-ATGTGACTAGATACC-3’ 5. 5’-ATGGGACTAGTTACC-3’1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt concentration to permit any hybridisation as appropriate)? Draw your answers depicting the hybridisation. a) GCC TTG AGC TTT TTT GCT CAA GGC (b) ATG ACT CTC GAG AGT CAT TTA TTA8. For each of the following DNA template strands а. 3' ТАCGGC 5b.3' ССАТТА 5' Determine: a. the base sequence of the DNA informational strands b. the base sequence of the hnRNA synthesized using the DNA template strand.
- 10. Analyse the following DNA sequences and identify and explain the anomalies you observe. Ifthere is no anomaly specify that as well. a.) 5’ A A T C T A G C T A A T T C G C A A A T T A A T C G 3’3’ T T A G A T C G U T T A A G C G T T U A A T T A G C 5’8. Which of the following is the complementary base pairing of the DNA sequence 5' ATTCGGCTTA 3'? a. 3' TAAGCCGAAT 5' b. 3' ATTCGGCTTA 5' c. 5' TAAGCCGAAT 3' d. 5' ATTCGGCTTA 3' 9. Why is DNA polymerase I used in prokaryotes? a. to repair damage to DNA base pairs b. to remove DNA sequences to form plasmids c. to fill in gaps between Okasaki fragments along the lagging strand d. to add DNA nucleotides to build new strands 10. Which set of labels is correct for the following diagram of DNA replicating? E Z A T C ATAGAC direction of replication C a. b. Alignment Paired Y C. d. Anti-parallel AATA GTT D a. X is helicase, D is ligase, and E is leading strand. b. X is gyrase, Z is leading strand, and D is single-strand bonding proteins. c. X is helicase, Y is replication fork, and D is single-strand bonding proteins. d. X is topoisomerase, Y is replication fork, and E is leading strand. 11. What term is used to describe the direction by which the backbone of DNA strands run to each other?…4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence
- A. Illustrate. Consider the given pair of homologous DNA molecules. T T' t t' Y Y' y y' L Ľ' I l' G G' g g Suppose the single strand breaks in the figure initiated an exchange of segments, and branch migration proceeded up to the L'-G' region. Following the color-coding and genotypes of the given DNA molecules,When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria2. Tube A contains 800 µl of a DNA solution that has a concentration of 345 µg/ml. a. You transfer 0.2 ml of DNA solution from Tube A and place it into Tube B. How much total DNA is present in Tube B?
