3. Label the structures marked in the following diagram of a sarcomere. A B 993393 999999 Sarcomere

Q: 18. Distinguish among the functions of the primary motor cortex, premotor area, and prefrontal area.

A: Brain is the vital organ  that help to maintain and regulate the basic activity of humans. The motor…

Q: pages of Synopsis and Report/Dissertation are different,

A: A simplified plan that is submitted before starting any research program is known as a synopsis. It…

Q: Why is marijuana not to be legalized here in the Philippines? more info and details for debate and…

A: Marijuana is the dried leaves and flowering tops of the Cannabis sativa or Cannabis indica plant.…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of  DNA is unique to all individuals.…

Q: Make a dichotomous key for beauty product or cleaning agent.at least 10 items. plse this is the…

A: A dichotomous key is a significant instrument, used to recognize various living beings or things,…

Q: Narrative of your experiences of research in daily life.

A: Nursing research is the application of scientific inquiry to the phenomena of concern to nursing…

Q: could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their…

A: In live-cell mechano transduction imaging and mechano pharmacological drug screening, biosensors…

Q: Let's Try (Evaluation) A. Direction: Read the statements carefully and identify whether the…

A: Neuron is the basic structural and functional unit of the nervous system. It conducts impulses from…

Q: Possible topic for grade 12 STEM students for concept pape

A: A concept paper is a short paper composed by a college understudy around an exploration question…

Q: When referring to the amino acid sequences of proteins, sequence homology is the same as sequence…

A: single mutation leads to a homologous protein, and yet may drastically change the structure and/or…

Q: 1. How do the central nervous system and peripheral nervous system differ from each other?

A: The central and peripheral nervous systems are the two components of the nervous system in animals.

Q: What is the importance of the aseptic technique?

A: Microbes are the tiny , microscopic organisms that cannot be visualise as such through naked eyes .…

Q: The E value should be as high as possible. True O False

A: Basic Local Alignment Search Tool  ( BLAST )-- BLAST or Basic Local Alignment Search Tool use of…

Q: I need help with with writing in Apa

A: APA- The American Psychological Association, or APA, is the institution that developed the…

Q: * Fays CISD 6 Schoology hayscisd. schoology.com marks G Image result for fan.. Image result for…

A: Given: Each term with its description.

Q: When or why is this genetic technology/process used? Who benefits from this genetic…

A: Recombinant genetic technology is the process of combining nucleic acid (DNA) of two different…

Q: Part I Confronting the Future Suzanne, a woman in her early 30s, has learned the devastating news…

A: Alzheimer's disease is an autosomal dominant disorder. This disorder is associated only with…

Q: Font Paragraph Styles Editing Drug What How does the drug interfere with the normal What effects are…

A: According to bartleby guidelines, when multiple questions are posted we are allowed to answer first…

Q: Some chemicals are known to cause mutations in DNA. EMS is a chemical that usually induces a…

A: Ethyl methanesulfonate (EMS) is a mutagenic, teratogenic and carcinogenic organic compound. It…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: What are the benefits to a patient of a recall appointment?

A: A patient recall is where the patient gets a notification for the regular appointments that are…

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: The solution ended up being incorrect on my homework. What would be another option?

A: A communicable disease is one that may be spread from one person to another or from an animal to a…

Q: answers above are partially correct, but more are missing. im confused on which one of the others…

A: Introduction Adenosine 5′-triphosphate (ATP) is a key "energy molecule" found in all living things.…

Q: why an understanding of mathematics is essential for those seeking to be employed in health-care…

A: Mathematics is the branch of science that deals with numbers, various shapes, and quantities. In the…

Q: 1.What forms 2 hydrogen bonds in the DNA double helix? 2.What forms 3 hydrogen bonds in the DNA…

A: DNA is the genetic material in most of the organisms . it is made of monomer units called…

Q: Question: The patient complained of pyrosis after heavy meals. Define this term?

A: Introduction: The digestive system comprises various organs that aid in the digestion of food and…

Q: How can you make an energy conservation task more challenging for a cancer patient? The less…

A: Cancer- cancer is define as an abnormal and uncontrollable growth of the cell in a part of body.…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: Please help me with these! Please leave me a paragraph of minimum 500 words with many informations…

A: Schizophrenia is a persistent, severe mental illness that has an impact on a person's relationships…

Q: What is the chemical nature of the enzyme primase?

A: Primase Enzyme is also known as DNA Primase. These are essential for the replication fork of DNA and…

Q: Build up your DNA Tom there your MRNA and your protelm 3 ATATTIT TACTTCAAACOGATT AUGAAGUUUGGCUAA Met…

A: So, the given DNA sequence is ATTTT TACTTCAAACOGATT In a DNA molecule four base pairs are involved…

Q: Would love a list of different types of nucleotide repeat disorders.

A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…

Q: What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted…

A: Bioinformatics is the field of biology that employs computational tools and analysis techniques for…

Q: Part 1: Cognitive ability and educational issues Piaget said that children in middle/late childhood…

A: The stage of concrete operations, as defined by Swiss psychologist Jean Piaget, signifies a pivotal…

Q: Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now…

A: Given, ACC GCG GTT TAC TTT GCC CGA ATT GAT GA