3. A recent report shows that a novel cytokine (STC) can increase the abundance of stem cells in mice's bone marrow. Boss K thinks that purified human STC can be injected into donors prior to bone marrow harvest. Worker P managed to express lots of STC in E. Coli and STC is soluble in E. Coli extract. Boss K wants Worker P to make a polyclonal antibody in rabbits and then use the antibody to purify STC in a large quantity for clinical trial.

4. The following applies for humans and not birds? A. lack of lymph nodes B. somatic DNA recombination C. presence of bursa of Fabricius D. somatic gene conversion is responsible for Ab diversity 5. Which of the following does NOT contribute to lg class switching? A. Cytidine deaminase B. class switch DNA recombinase C. Cytokines D. recognition switch signal E. Terminal deoxyribonucleic transferase(TdT)

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

IgG is one of five classes of antibodies that can be produced by our immune system. I9GS have a molecular mass of approximately 150 kDa, what is their subunit composition? OA. 1 light chain and 1 heavy chain O B. 1 light chain and 2 heavy chains OC. 2 light chains and 2 heavy chains O D. 2 light chains, 2 heavy chains, and a J chain O E. 4 light chains and 2 heavy chains

When IgG is cleaved with a protease that targets the hinge region, which of the following is generated? a. two Fab fragments and one Fc fragment b. two Fc fragments and two Fab fragments c. Fc fragments that bind antigen d. Fab fragments that facilitate antibody effector function e. a membrane-bound form of antibody.

9. please answer this . very important

You plan to synthesize a peptide to be used as a vaccine to treat melanoma, a particularly aggressive form of skin cancer. Normally, gp100, a protein on the surface of melanocytes, activates cell growth when it is bound by its ligand. Activation of the growth pathway depends on the presence of threonine in the ligand. The effective peptide vaccine will mimic the natural ligand, but won’t cause cell growth and division. Below is the sequence of the natural ligand:   LDMKTAG   In order to ensure your newly designed peptide vaccine does not cause cell growth upon binding, you must substitute the Threonine residue at position 5. What amino acid would you replace it with, bearing in mind that the peptide should still be similar enough to bind to the gp100 protein in the surface of melanocytes. Explain your choice. Your vaccine will be administered as a topical cream, and you require your peptide to have an overall neutral charge in order to be functional. At what pH should you formulate…

1. One of the following sentences is NOT correct A. P53 is an example of tumour suppressor gene B. Wright's stain is sued to visualize a peripheral blood smear C. leukotrienes are derived from arachidonic acid by cyclooxygenase D. effective bacteriocidal enzymes are contained in lysosome of the neutrophils E. H&E stain is the most commonly used tissue stain for routine histological examination F. proteoglycans are located in the ECM but not in the ground substance of connective tissue 2. Which of the following sentences is NOI correct? A Microvilli increase the surface area of the epithelial cells B. Desmosomes are an effective barrier to the diffusion of substances across an epithelium C. Epithelial tissues are classified by the shape of the epithelial cells in the basal layer D. Release of lipid droplets from cells is a type of merocrine secretion E. Epithelial tissues are classified by the number of cell layers F. None of the above G. Both A and E H B. C and D 3. Which of the…

8) The diagram to the right shows some of the DNA in a bacterium into which a human gene, X, has been successfully inserted. The bacteria that results from reproduction of this cell will most likely have the ability to DNA of bacterium Cell wall of bacterium replicate all of the genetic instructions found in humans produce vaccines to be used to immunize humans produce a human blood cells according to instruction in gene X O produce the human protein coded for by gene X

Which of the following would you expect to happen if there were a mutation in the Iron Response Element (IRE) that prevented IRE-binding proteins from binding to the IRE.  The ferritin gene will only be translated with a low concentration of iron The ferritin gene will only be translated with a high concentration of iron The ferritin gene will be translated, regardless of the concentration of iron, The ferritin gene will not be translated, regardless of the concentration of iron