Chargaff¨s Experiment Table 1. Nitrogen Base Make-Up of ifrent Organisms' DNA (in Percentages)OrganismMycobacterium tuberculasisYeastWheatSea UrchinMarine crabTurtleAG34.914.632.9|27.132.135.417.1|22.815.131.3|27.332.818.7|22.717.717.32.722.02.721.347.347.329.728.630.927.9Rat|28.421.421.5Human|29.419.919.8 2. What observations can you make about the data in Table 1? What patternsdo you notice?3. What does the data in Table 1 show about the makeup of DNA for differentspecies?4. How does this support the idea that DNA could be the genetic material?Explain.

Chargaff's rule proposed by Erwin Chargaff states that the purine content is always equal to…

Answered: 2. What observations can you make about…

Science

Biology

2. What observations can you make about the data in Table 1? What patterns do you notice?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter46: Ecosystems

Section: Chapter Questions

Problem 22RQ: The process whereby oxygen is depleted by the growth of microorganisms due to excess nutrients in...

See similar textbooks

Related questions

Q: 7. High school students entering the science academy were split into two groups and each received a…

A: The independent variable is the cause or variable that is changed while the dependent variable is…

Q: 5. The criterion that is used to distinguish the relationship between two species A. Geography…

A: A species is defined as a group of actually or potentially interbreeding populations that are…

Q: 15 Which of these is a conclusion the student could make based on the data? A. The Sun, moon, and…

A: Earth is a planet in the solar system on which life is possible and we all live on the earth. The…

Q: 4. Which species appear to have evolved most recently?

A: The phenomenon of evolution of a population to form distinct species is called speciation. A group…

Q: 1. What is the Twilight Zone? A. Where alignments appear plausible and are statistically…

A: Bioinformatics is the field of science in which biological information about various organisms is…

Q: 1. Differentiate continuous traits from discontinuous traits. Cite examples for each from the data…

A: Continuous and discontinuous traits are used to define variations occurring in a species due to…

Q: 4. When and how were fingerprints first used in the United States? 5. Describe the difference…

A: INTRODUCTION Fingerprints are a very important indicator to differentiate one individual from…

Q: What is the independent variable for figure 1? 2. What is the dependent variable for figure 1? 3.…

A: Predator The species that hunt and eat the other species are known as predator.

Q: 1. List five assumptions of Hardy-Weinberg principles.

A: As it The Hardy-Weinberg Equation is a mathematical formula that was developed by Hardy and…

Q: Are there any advantages in breeding organisms from closely related species? Explain.

A: Breeding is a process by which two High quality organisms are mated with each other to produce high…

Q: 1. Explain the statement "When environmental conditions reverse, so does the selection pressure".

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: 2. What was the original hypothesis? 3. What was the manipulated (independent) variable and the…

A: Beriberi is a disease caused by a vitamin B-1 deficiency, also known as thiamine deficiency.

Q: What is the significance of the process of speciation to biological biodiversity?

A: In evolutionary process different species are evolved in the nature by different mechanism that…

Q: 9. Given the observed genotype frequencies in Part I and relative fitness values from Question 8,…

A: Fitness refers to how well an organism passes its own genes to the next generation. It refers to the…

Q: 5. Which constant was controlled in Jose's experiment so that it would not affect the predicted…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: 1. If the student would test the air bubbles collected in the test tube, what would she find they…

A: Photosynthesis is the process performed by plants to make their food and then in turn it releases…

Q: 1. Count the number of light-colored and dark-colored mice present at each location at each moment…

A: Inference refers to finding or giving some logical conclusion for an observation. Inference should…

Q: 4. How are the predator and prey graph lines related to each other?

A: To determine the presence of predators is very necessary to safeguard them. There are many cues and…

Q: if something is 1g/hr how many μg/s is it? Give the first 3 digits of your answer.?

A: Mathematical calculations and conversions are very important in the field of biochemistry in that…

Q: 19. Which of the following "range of phenotype" graphs best captures this story: a species of beetle…

A: The natural selection depends on the reproductive fitness of the individuals. Nature always select…

Q: 6. In a population of 800 people, if p= 30%, what are the expected numbers of individuals with the…

A: p2 + 2pq + q2 = 1 and p + q = 1 p = frequency of the dominant allele in the populationq =…

Q: I believe that the correct answer is: p^2+2pq+q^2=1 I just want to make sure that I am…

A: Introduction :- The hardy weinberg principle states that in the absence of other evolutionary…

Q: Why are classification system changing every now and then?

A: Carl Linnaeus in 18th century classified organisms into eight levels based on characteristics and…

Q: 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is…

A: Answer :: Step 1 of 3 :: Cladistic is a diagrammatic representation which determines evolutionary…

Q: 7. While there are many criteria to describe the difference between two species, thế biological…

A: A species is characterized as the group of organism in which any two individuals of the different…

Q: 5) You want to know if an octopus (octopi are very intelligent!) can tell the difference between…

A: Number of times the octopus picked up the circle, c=11 Number of times the octopus picked up the…

Q: 5. It is possible that these two types" of lice are two different species cr are two different…

A: The biological classification gives us a rough idea regarding the common and distant characters of…

Q: 2. In what situation might populations in game reserves or national parks exhibit Hardy-Weinberg…

A: If a population is in Hardy-Weinberg equilibrium then the allele frequencies and genotype…

Q: 15. Identify the animal groups that are different varieties (or subspecies) within the same species.…

A: Species are considered as a basic unit of biological classification.It involves the grouping of…

Q: 9. A biologist knows from past research that the average length of a leaf of a specie of full-grown…

A: A hypothesis test is a statement of any population parameter. Testing a hypothesis is understanding…

Q: Ama’s mother uses the Authoritarian parental style. His dad who is laid back would rather use the…

A: Data is the information collected to conduct a research study, if a researcher is conducting a…

Q: 1. Given that the Hardy-Weinberg principle occurs only under conditions that populations in nature…

A: Hardy-Weinberg equilibrium principle states the static behavior of allele and genotype frequencies…

Q: 1. How can you tell which data is an independent variable? Dependent variable? 2. What kind of data…

A: Introduction:- Independent variable is a stand-alone variable that isn't affected by the other…

Q: 1. Based on esults, wino was the or disease? Explain how you came to your conclusion. Were you able…

A: Carrier 4 is the original carrier as in exposure 1 , 4 comes in contact with 10 and infects it. In…

Q: 1. Select the true statement(s) about statistical significance. Select all that apply. Experimental…

A: Null hypotheses are defined as the statement that is assumed to be accurate or correct unless it can…

Q: 5. Why is it an issue that hatchery fish breed with wild fish? It's an issue because 6. Why in the…

A: 5. When they breed with the wild fish they weaken the whole population as the hatchery fish has less…

Q: 2. What is binomial nomenclature? Answer:

A: Nomenclature is a system of naming organisms used in biological classification. The genus and…

Q: 19.All the following are methods used in probability samples except one: a. Simple random sampling…

A: As per the guidelines we are supposed to answer only thr first question in case of multiple posted.…

Q: ii) The actual data is shown below. Does this ratio match your expectations If not, explain why…

A: Chi square test is used to determine whether there are found significant difference between observed…

Q: 3. Analyze the following graphs and determine what kind of correlation is it is displaying.

A: 1st graph is : XY- linear graph 2nd graph is: scattered graph.

Q: 15. What is punctuated equilibrium? How does it differ from classical gradualism?

A: Introduction: Evolution refers to the change in the species with time. Every single species living…

Q: 3.  What is the length? ◦ A. ◦ The distance between 100 points ◦ B. ◦…

A: Length is a measurement value that is used to measure the distance between objects. The standard…

Q: 1. Describe at least five conditions required for the Hardy-Weinberg principle to be true. Explain…

A: In population genetics, the Hardy-Weinberg principle states that allele and genotype frequencies in…

Q: 13:10 l 5G Done Photo Use the following information to answer question 3. In sheep, white wool is a…

A: The total population of sheep is 500 20 sheep have black wool. White wool is a dominant trait.…

Q: 4. When 2 people use the same dichotomous key to identify the same specimens, is it possible for…

A: Introduction:- A dichotomous key is a method of identification whereby groups of organisms are…

Q: How Do You Apply What You Have Learned? Activity 1: Genetic Drift Simulation Objective: To show the…

A: The process of evolution is a critical and time- taking process. evolution does not just arise from…

Q: In the floating egg experiment, why do you think that the egg floated when salt was added with…

A: Water is directly and intimately involved in various body physiology, it is also in art space pillar…

Q: Give 3 similarities between the lock and key model and the induced fit model 2. Give 3 differences…

A: The main difference between the advertised balance and lock and the key model is that in the…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

_{Chargaff¨s Experiment}

Table 1. Nitrogen Base Make-Up of ifrent Organisms' DNA (in Percentages)
Organism
Mycobacterium tuberculasis
Yeast
Wheat
Sea Urchin
Marine crab
Turtle
A
G
34.9
14.6
32.9
|27.1
32.1
35.4
17.1
|22.8
15.1
31.3
|27.3
32.8
18.7
|22.7
17.7
17.3
2.7
22.0
2.7
21.3
47.3
47.3
29.7
28.6
30.9
27.9
Rat
|28.4
21.4
21.5
Human
|29.4
19.9
19.8

2. What observations can you make about the data in Table 1? What patterns
do you notice?
3. What does the data in Table 1 show about the makeup of DNA for different
species?
4. How does this support the idea that DNA could be the genetic material?
Explain.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

020-2 b My Qu X All Cha Nazare Permis h BIO210 Co X Master Anator Chapte um.ecollege.com/course.html?courseld%3D156741508OpenVellumHMAC=54e94737743258a7158dac000d4797e4#10001 Chapte Q Upgra Q Ch. 4 F
In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? O Parasiticum mucoides O Both infections are equally likely Donoteatum thisbacterium There is no way to know given the information provided MacBook Air DD F9 80 000 000 F8 F7 F6 F5 F4 F3 *
14. 1ou haVe one attempt at this qUz and have a tot Question 1 Bacteria living In the colon have what type of 'relationshlp' with their human host? O parasitic . O mutualistic O commensalistic 0.regative Question 2 What is resident flora?
This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
The worldwide spread ofmultidrug-resistant (MDR) pathogenicbacteria has becomean urgent threat to human and animalhealth. More than two million people inthe United States become infected withantibiotic-resistant bacteria each year, andmore than 23,000 of them will die fromtheir infections. In 2015, approximately480,000 cases of MDR tuberculosisoccurred worldwide and another 100,000cases were resistant to at least one antibiotic.In the United States, cases of drugresistantenterobacteriaceae infectionsincreased three-fold between 2001 and2012. In 2016, a woman in Nevada died ofa Klebsiella pneumoniae infection caused bya strain that was resistant to 26 differentantibiotics, including colistin, which is consideredthe “last resort” antibiotic.One factor leading to the spread ofMDR bacteria is the selective pressurebrought about by repeated exposure toantibiotics. Worldwide, livestock consume used as feed supplements. The routineuse of antibiotics in livestock feed and theoveruse of human…
The process whereby nitrogen is brought into organic molecules is called.___________ nitrification denitrification nitrogen fixation nitrogen cycling
1-ZA: MICROBIOLOG X Gyes or no Measles is an ex x a A https://docs.google.com/forms/d/e/1FAIpQLScarFK5blZrF4szvrYJcXtBP9s_fgUvBMwqmKjcBQTvY5CaFQ/formRespc Which of the following is TRUE regarding bacteria? Bacteria help produce vitamins in our digestive system Bacteria help clean our intestinal walls and help digest food Bacteria are involved in the production of a variety of foods we consume All of the above are true Which of the following statements concerning viruses and human health is 1 false? in many diseases caused by viruses, the virus attacks cells as it reproduces many viral diseases can be controlled through vaccinations some viruses can remain dormant in the body for years before disease symptoms appear most viral infections are difficult to treat, but they can be finally destroyed by antibiotics
V e. kidney stones Which of the following microorganisms require the major available (aW) of water to proliferate? ¿Cuál de los siguientes microorganismos requiere la mayor cantidad de agua disponible (aW) para proliferar? O Penicillium spp. O Xeromyces spp. O Escherichia coli O Pseudomonas aeruginosa O Staphylococcus aureus Mention and describe the two types of bacterial resistance to antibiotics. Mencione y describa los dos tipos de resistencia bacteriana a los antibióticos. A-
O Mycobacterium tuberculosis Question 23 A patient has an infection caused by a bacterial species that produces toxins that are capable of breaking down DNA and dissolving hyaluronic acid. Which disease does this person have? O Meningitis O Pertussis O Necrotizing fasciitis O Shigellosis Question 24 During which phage of Bordetella pertussis infection will you hear the characteristic 'whoop' sound? O Incubation MAY 12
A New tab A Dr.Haider question.pdf O File | E:/Msc/Second%20Course/Molecular%20Biotechnology/Dr.Haider%20question.pdf + CD Page view A Read aloud V Draw 9 Highlight O Erase 2 of 6 1. In industrial fermentation, which step precedes downstream processing? A) Removal of waste. B) Introduction of microbes into chamber. C) Packaging of product. D) Fermentation. 2. Which of the following is/are currently being produced through biotechnology? A) Glycerol. B) Vitamins. C) Steroids. D) All of the above. 3. A region of DNA in a plasmid that is recognized by a wide variety of restriction enzymes is called the A) Origin. B) Regulator. C) Multicloning site. D) Vector. 4. Fluorescently labeled probes are used in techniques. A) Culture techniques. B) VBNC. C) FISH. D) MPN. 5. Which of the following is initially spotted on the surface of a microarray chip? A) DNA sequences corresponding to known genes. B) MRNA. C) Fluorescently-labeled CDNA. D) Protein. 6. What information can be obtained from a DNA…
QUESTION S Penicilin which is naturally produced by the mold Penicillum notatum to kit bacteria is the first discovered Oa antibietic Ob eynthetic antimicrobial Oc semiynthetic antimicrobial Oa chemetherapeutic drog QUESTION S What s meant whin a bacherkim is said to become resistant to an antibiotic? OA The antbiotic kh or inhibits the bacterkum O The antibiotic in metaholzed by the bacteriom, providing more energy for growth of the cell OE The bacterium is neither kied nor inhibited by the antbiotic O The antibiotic mutater way that benefits the bacterlum
Chapter 9 L discusses some oxygen requirement, grouped. We're going to focus on those that do not necessarily need oxygen for survival. For this part: aerotolerance, categories under which most prokaryotic organisms can be 1. What oxygen requirement, or aerotolerance, categories allow for an organism to survive in the complete absence of oxygen? Please list those oxygen requirement/aerotolerance categories where an organism doesn't necessarily need oxygen for growth. 2. Oxygen is toxic to most organisms, even you! One reason we don't see the effects of this is because most organisms are able to produce enzymes to counteract this toxicity. This is called, "detoxifying reactive oxygen species (ROS)," as discussed in Chapter 9. In order to survive in the presence of oxygen (if it can), a prokaryotic organism must be able to undergo detoxification of reactive oxygen species. For each category you listed in 1), please provide: A. the enzymes that may be lacking/missing in order to detoxify…