Q: :BCI can be considered as a Long last systems (can be used for a long time like years). O Short last…
A: BCI It is Brain–computer interface. It measures CNS activity and converts it into artificial output…
Q: (e) Fill the folowing (i) Li(3, 6)+? → Be(4,7) ± n(0, 1) (ii) Br(35, 79) ± H(1,2) →? + 2n(0, 1)
A: Subatomic particles are composite particles which are smaller than atoms and includes electrons,…
Q: Help Save & Exit The chance that an outcome will occur in the future Is called the outcome's…
A: In statistics, we can see the chances of an event to occur or not. Various variables can be compared…
Q: which of the following is not suffix of GATTACA? 1 CA 2 TTACA 3 GATT 4 A
A: DNA or RNA sequence are aligned so as to understand differences and similarities between the two…
Q: 0.1.1 BIOL 112 Continuous as- 8. sessment 2012/2013 REMINDER The likeness of the believer in their…
A: Since according to our guideline we are allowed to answer a single question at a time. If you want…
Q: 3. Climate is what we ( ). 4. Weather is what we ( ).
A: Climate means the weather conditions which are now ascertained because they are happening same over…
Q: dand en culaire du cerveau humain mp so of the Anst al f e the Human Beain ry p sne telsystems vom…
A: The brain is one amongst the largest and most advanced organs within the body. It is created from…
Q: 2. Which habitat is most likely to have the greatest blodiversity? O Alpine region of Switzerland…
A: Biodiversity refers to the variety of organisms that are present in the particular area or…
Q: 1. Which of the following tic of a good classifica a. It shows relationsh b. It is meaningful. c. It…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: The
A: Introduction :- A monohybrid cross is a genetic mix between two individuals who have homozygous…
Q: A is B is Cis D is E is Fis G is
A: During the blood circulation when blood reached the tissue capillaries then some amount of fluid…
Q: 1. 720 desiruction 2. of vegetation 120 3. 2. 5.
A: Carbon cycle play's a crucial role within the earth. That is, it tells us how co2, which is know as…
Q: 22 m Taranto, Italy °C mm 17.2°C 538 mm 300 in climate: ight... 40- and a moi 80 30 - 60 20- 40 10-…
A: Evapotranspiration is basically a process by which water is transferred from the land area to the…
Q: An Ap-horizon is formed by the plow 1. True 2. False
A: Soil horizons are the different layers of soil present in soil profile.
Q: 4. What percentage of carbon-14 is left after 11.2 thousand years? 100 75 50 25 0.0 5.6 112 168 22.4…
A: C14 is used in radio carbon dating. In nature the C14 is decaying to N14. The half life of C14 is…
Q: 3. Potential ways to increase global fo- food supplements for livestock animal A. developing desert…
A: The global food system has a huge impact on the environment, with greenhouse gases, water…
Q: State the ff: a.) Hypothesis of Clark b.) Hypothesis of Paton c.) Hypothesis of Ariens &…
A: Ans. a) Hypothesis of Clark It is one of the drug-receptor theory, it stated that the…
Q: adaplations food prickly running sheller burrows juicy rain cooler mountains rain shadow waler ears…
A: A desert can be defined as barren land that has very little vegetation and water sources.
Q: lo atqesno yat ert ylitnobi pns woled anoitsutia paiwollo orli beeA.I 4 3 Why would a deer be more…
A: Survival of fittest, is a natural process of selecting organisms which are best adapted to their…
Q: What are the environmental of desposition that is implies on the following: A.Stellated B.Roseiform…
A: depositional environment or sedimentary environment describes the combination of physical, chemical,…
Q: 9/26 What is the best analogy for the nucleus's job? Construction site Storage tanks Transport…
A: Cell is the basic structural and function unit of life. It is the sub unit of the body.
Q: 15. Which of the following is true to theory and scientific law? a. ANSWER: RATIO: Scientific law…
A: We'll answer the first question since the exact one wasn't specified. Please submit a new question…
Q: Graptolites colony increases by Select one Juippnq e b. rubbing C. colonies d.connecting Clear my…
A: Graptolites were colonial animals that lived in a tube structure that was interconnected.
Q: - and 30 minutes) commends a bowl of freshly boiled garlic water to cure CC Do a fact-check to prove…
A: The Covid-19 pandemic viral disease is spread by virus rather than bacteria. These viruses primarily…
Q: Which of the following is not a suffix of GATTACA? Select one: O 1. CA O 2. TTACA 3. GATT O 4. A
A: The DNA is the genetic material. It regulates the expression of cell.
Q: A. only one B. about 3 or 4 C. a dozen or more D. as many as possible
A: An experiment usually consists of three variable i.e. independent , Dependent and controlled . The…
Q: A G- H В C F A B E Guy/99 Livingstone BIODIDAC Livingstone O BIODIDAC Figure 2. Frog's Internal…
A: Humans and frogs share comparable neurological, circulatory, digestive, and breathing systems. Both…
Q: 1) CaHe+O2 → _CO2 +_ H20 2) Al+ FesN2 →AIN + Fe 3) Na + Ch NaCI 4) H2O2 > H20 + O2
A: The symbolic representation of any chemical reaction is said to be a chemical equation. In a…
Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…
A: In evolutionary biology, mimicry refers to an organism's developed likeness to another thing, most…
Q: 4. If the malaria parasite is eradicated from an area where it used to be prevalent, what expect to…
A: Introduction :- Malaria a disease which is caused by the plasmodium protozoan , for example :-…
Q: 10. If a gardener brings plants from Hawaii to New York- the plants would now be in a new...…
A: The garden took plants front their natural habitat which was Hawaii to new York.
Q: 16 Mosquitoes pose a constant health risk in Florida. Based on the illustration above, what would be…
A: To reduce mosquito numbers :-
Q: 10. What variable is the one that you can manipulate or change? It is sometimes called the…
A: Question - What variable is the one that you can manipulate or change? It is sometimes called…
Q: 17 of 22 In a popula“ survivors a
A: Both allele and genotype frequency remain same in a population generation after generation if there…
Q: nue to be
A: Paraphyletic:- If a group's last common ancestor and all descendants of that ancestor are included,…
Q: ally growing bacterial population increases its number from 10³ to 1014 cells in 8.5 hours. final…
A: Population growth rate measures the number of individuals in a population (N) over time (t). When…
Q: Which situation would most likely produce a gene mutation in a O the squirrel is exposed to…
A: As shorter wavelength light (such as blue light) is concentrated on the retina, less quanta are…
Q: Station 4 7. List all the characteristics that make the pasta a living or a nonliving thing. 8.…
A: There are many characteristics which allow to determine whether a particular thing is living or…
Q: 3. In the MRSA case study discussed in class, after 12 weeks a mutant arose. This mu- tant formed…
A: Small colonies means small population of mutants is growing. To interpret the answer let's define…
Q: 2. What will happen in year two after the first spraying of insecticide B? (Select all that apply.)…
A: Pests are the destructive insects or other organisms that attacks food, crops, livestock, etc.…
Q: Need help only with b and c.
A: Malaria is a life threatening disease caused by the Protozoa Plasmodium which is carried by female…
Q: ain also.
A: Jawless fishes are about 100 species. Bony fishes are about 58% if all species so, they are the…
Q: 8:52 AM Sun Sep 4 Students Home Dive duration (s) Max dive depth (m) 53.82048397 32.89114327…
A: Predation is an ecological interaction where one organism kills another one to eat. The organism…
Q: 24 What statement best explains why invasive species outcompete native species in a particular…
A: NATIVE SPECIES It is defined as an indigenous to a given region or ecosystem if its presence in…
Q: In death phase, what is TRUE about g? O t is less than log phase g It is higher than log phase g O…
A: Microbial growth curve represents the status regarding the vialbility of microbial…
Q: in a village where the proportion of individuals who are susceptible to malaria (genotype hba/hba)…
A: Answer: Hardy weinberg equallibruim = This is the equation which represents the relationship…
Q: 3. Which of the following factors is thought to be the most protective against colony collapse…
A: Answers : colony collapse disorder is the death of honey bee colonies. This disorder makes the bees…
Q: (4) Throughout most of human history, for nutritional purposes human beings have gotten (a) 90% of…
A: The act of maintaining ecological balance by preventing the depletion and loss of natural resources…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- A Cla OR S Sa E My E Ke E IX P re E To: E Kes E Kes E Ke E Ke R Re. E CW Ke * Cal a docs.google.com 82 LOK CILPER O SDPBC Bookmarks A Classes O YouTube SSavvas Realize .it Paraphraz.it | Parap. C Single sign-on for e. G Grammarly O mydistrictportal IXL Ryan lives in a house near a small lake. In the past few months, he has 1 point noticed that there has been very little rainfall due to a drought. He monitored the water depth in the lake by inserting a metal cylinder in the sand and marking the water level each week for 4 weeks. He recorded his data in the table below. What would MOST LIKELY take place in the lake ecosystem based on this data? * Water Levels of the Lake Water Level on Cylinder (cm) Week 1 120 Week 2 96 Week 3 88 Week 4 57 The fish population would decrease due to competition for food and shelter O The deer population would increase due to increased space for habitats Trees near the water's edge will grow twice as fast during the drought O Fish-eating birds would find it…Downloads G https://quizizz.com/joln?gc 組■回 O O 4x * -> A quizizz.com/join/game/U2FsdGVkX19TkkG3kLlisiMvowuyNnqAj4DOrKAİ%252BrxJxaTyev6Woj05VE1vYBQ81Qrk%252.. DeltaMath G Sign in - Google Ac. C Campus Portal Desmos | Graphing.. O Copy of Cherish sto. G Continue the Conve. 国 Readil HCS Bookmarks Y 10th 27500 +200pts What is the art of persuasion? rhetoric pathos ethos logos Music off O v1 3:17 Cophiem X0M Qualtrics x Assessm x G What sh X Microso X O Mail-MX G translate x + uta itre sOVBISLYaKWzue2 TULIYT m TI UTIRO RRUO Imagine you are one of the first people to arrive at this accident scene. You need to identify the hazards that might be present and decide what you can do to control them to prevent further harm. View this list of hazards and select those that you recognise from the image above pe here to search hp %23 4. R G H. alt B.
- i in Course: 23SPCMP Anat & Phys... N The tissue type that is indicated by the black line in this image is Fill in the blank #3 Q E $ 4 R M Question 36-Lab Practical 1 -... F % 5 T G * 0 8 4+ 1949 9 The tissue type that is shown im ) 0 Helpnt/d/1GDrCbzwuSuXex9PVIC2TAEXU28J-oGZWocd06bFOtM/edit y hoote.. C Campus Student Apex Learming My Account -Study.. Duolingo - The worl.. K PL cry Study Guide O Add-ons Help Last edit was 2 minutes ago BIUA Delius 12 1 2 3 Cl 4 5. Humans obtain the energy and matter they need in order to survive by eating food and the bonds between the atoms. 7. Which would provide more energy: a monosaccharide or polysaccharide? Why? B. Which bond would have more energy? C=C or O-H? 9. Explain how ions are formed when a sodium atom comes into close contact with a chlorine atom. 10. Identify the following as either chemical change (C) or physical change (P) baking a pie !!!1696299405-SBI4U Test... & Preview File Edit View Go Tools Window Help 4 Apoft being educach pr er her s me Dining may waters and the day of the act of DCA I har ful 4 Part-Thinking and Ingairy (15) Camp Bukaryti gone uplates to Prakaryotic game regulation. What the 3. modderpoed for Deplication What they called How are they dont 5 P 5. Dedimxplain the process of transcription. Add 4 Frock point todemontherf of genc 6 P wwwwww V انادا در در درست 1696299405-SBI4U Test 3.pdf Page 6 of 10 days of this course. Please remember the Dropboxes will close 22 280 JAN 22 4. Outline the steps of Frederick Griffith's experiment on mice to demonstrate the transfer of genetic material using Streptococcus pneumoniae. tv V 2 U₁ Search 9 23 Page 5 of 10 80 ((( O Mon Jan 22 6:19 PM All Bookmarks A U
- choose correct option nd do explain shortly plz.in Course: 23SPCMP Anat & Phys... The tissue type that is shown in this image is @ 2 W 3 Q E $ 4 M Question 40 - Lab Practical 1 -... R % 5 T Be as specific as possible. * 8 + ( 9 GThe tissue type that is she LM 500x H PCATGATACAAGGCCCTTCCGGTACAACCACTTCGGTAGAAAGCCTTTCGGAGACCGTCCCTTOGGCAGACGCAACmI cear CA PESCA CROOngm O uaNOCIGa P L CEIC00PORMORlg mcaGccCTTCCGGT 916 10 5'UTR 20|JATG 3b 50 Leader 60 80 100 1 110 130 160 2 40 70 90 120 140 150 170 180 190 ....I....I....I....I.. ..r....I........I....I....I....I....I....I........I....I....I....I....I....I....l....I....I........I....I....I.......I....I....I....I....I....I....I.........I .1....I.... DQ183132 DQ183133 DQ183134 ...2 -TCGGAGAGACTATTACTAACATG TCGGAGAGACСТАТТАСТААФАТО TCGGAGAGACCTATTACTAACATG 3 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCCCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCGCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185…
- Plz do explain shortly why you choose.Pls help me answer this question and give a little explanation I am lost of what I am doing wrong in here?!A Did you finish your interirm? If no x e Edcite Q 24| 2021 SCLGB_12_MI X C Clever | Portal A edcite.com/apps/MOElemViewer?assignid%3Dnhaadmin_1611780315611&exid%3Dnhaassessments, 2021 SCI G8_12_MI;12465/24 OF 25 Re Notes C Q Line Guide Question 24 - Use the information below to answer the question. Sumaumeira, a variety of the kapok trees are the tallest in the Amazon rainforest, growing over 200 feet high. They produce anywhere from 500 to 4,000 fruits at a time, each containing approximately 200 seeds! Base of a sumaumeira tree (left) and opened and unopened fruit (right). Review /End Test Flag Options hp