1. Read a list of fictional characters from a file named "Characters.txt" and store them in a Python list of dictionaries. Characters.txt: "Harry Potter", "Harry Potter series", "J.K. Rowling" "Frodo Baggins", "The Lord of the Rings series", "J.R.R. Tolkien" "Sherlock Holmes", "Sherlock Holmes series", "Arthur Conan Doyle" "Lara Croft", "Tomb Raider series", "Core Design" "James Bond", "James Bond series", "lan Fleming" "Katniss Everdeen", "The Hunger Games series", "Suzanne Collins"
Q: To get credit for this assignment, perform the instructions below and enter the code you get from…
A: The objective of the question is to create a MySQL database, create a table in the database, insert…
Q: part A Attempt to violate the primary key constraint and observe the result. part B Attempt to…
A: Primary key ensures that the values in particular column is unique. It cannot have null values.…
Q: structions: (Fill in the columns of the "Calculations Table") 1. Create each formula to…
A: SOLUTION -This is an Excel Problem in which we need to solve three parts:(a) To find the Total Days…
Q: In the expression 48:(14*3), are the brackets necessary? What happens when you type 48:14*3?
A: In the expression 48:(14*3), the brackets are necessary to ensure that the multiplication operation…
Q: Please answer in complete sentences and paragraphs The configuration shows the commands entered by…
A: PCA and PCB typically refer to two distinct hosts or devices within a network…
Q: Que Which of the following is not an objective of a disaster recovery plan? O Minimize the extent of…
A: The objective of a disaster recovery plan is to minimize the negative effects of an incident on…
Q: fast please c++ Insert the elements of A in hash table H of size 10. H is a vector of int is size…
A: The objective of the question is to create a hash table of size 10 using a vector of integers in…
Q: Create a fee invoice application for students attending Valence College, a college in the State of…
A: The objective of the question is to create a fee invoice application for students attending Valence…
Q: 1. Imagine a very long bridge across the Mississippi River. A car will take upwards of 15 minutes to…
A: The Dining Philosopher's Problem is a classic synchronization and concurrency problem in computer…
Q: In the test class below, integrate another method to existing method to: Print the minimum values…
A: The objective of the question is to modify the existing Java class to include methods that find and…
Q: Solutions to a dynamic programming problem have (at minimum) three things: – A recurrence relation –…
A: In that case; Here's a dynamic programming algorithm for the problem described: Recurrence…
Q: 1. What is the value returned by xMethod (4), where the method xMethod is defined as follows: A. C.…
A: The xMethod is a recursive function defined in Java. It takes an integer n as input and calculates…
Q: 1a. The language accepted by the final-state PDA shown in Fig. 1 below is: 1b. The language accepted…
A: The diagrams you've provided are representations of pushdown automata (PDA), which are computational…
Q: part A Attempt to violate the primary key constraint and observe the result. part B Attempt to…
A: The reserved table in the image has a primary key that consists of two columns, stdid and bid. A…
Q: Write a function set_elements() that assigns 1 to the last and fifth elements of a list parameter.…
A: The objective of the question is to write a function that modifies a list by setting the fifth and…
Q: Please explain in full sentences and paragraphs Explain briefly the steps of the Divide and…
A: The divide and conquer troubleshooting approach is an organized method primarily used in complicated…
Q: Integer grid_size is read from input, representing the number of rows and columns of a…
A: Acquire user input in the form of an integer, denoted as grid_size, to represent the dimensions of a…
Q: Refer to image: (Computation and Automata) Provide new and correct solution for positive feedback!
A: The Required answer:Explanation:
Q: List pressure_data contains integers read from input, representing data samples from an experiment.…
A: 1. Read input from the user.2. Split the input into tokens.3. Initialize an empty list named…
Q: What are the key principles and components of computer networking protocols, and how do they…
A: Computer networking protocols are defined as the set of rules and practices that control…
Q: Use the information to solve Part A please. No Ai
A: To guide you; To draw the traces from the processor's point of view, we'll follow the sequence of…
Q: Define a function print_repeated() that takes two parameters and outputs the first parameter the…
A: The objective of the question is to define a function named 'print_repeated' that takes two…
Q: Ex 6) assume there is a webpage containing an HTML input of type text and a button. When the button…
A: A flowchart is a graphic depiction of an algorithm or process made up of shapes and arrows. It…
Q: String replacement is read from input. Then, sentence is read from input. If replacement is in…
A: The objective of the question is to perform certain operations on a string based on the user input.…
Q: what are the different layers in the TCP/IP protocol suite and their location, main function, and…
A: A network is an assembly of linked nodes or entities that can communicate with one another by…
Q: Ex 8) Draw a flowchart for a computer program that will receive numbers andoutput if they are…
A: The objective of the question is to design a flowchart for a program that accepts numbers as input…
Q: Strings all_colors and updated_value are read from input. Perform the following tasks: Split…
A: The objective of the question is to manipulate a string of colors separated by commas. The string…
Q: For this C code, find the values of a, b, c and d that give hit = 1, and the result #include…
A: In this C code snippet, the objective is to determine the values of variables a, b, c, and d that…
Q: Consider a simple authentication protocol below. A simple authentication protocol (1) C➜ AS: III ||…
A: This question examines security flaws in a simple authentication protocol. It belongs to the subject…
Q: orms Addition, Subtraction Mu
A: SQL (Structured Query Language) is a domain-specific language used for managing and manipulating…
Q: Automata and Computation question: Provide correct and new solution that fits the prompt!
A: Conditions: A, B, C, D, E, and F Alphabet: {0, 1} Changes:A -1-> B A -0-> C B -1-> D B…
Q: Why is the native function gets() problematic in the context of C string considerations? A. gets()…
A: The correct answer is D because it highlights one of the main reasons why gets() is problematic in…
Q: Please help me with this. I am having trouble understanding what to do. Programming Language: HTML,…
A: The objective of the question is to design a flowchart for a program that accepts numbers as input…
Q: Given the table PRODUCT(ProductID, ProductName, ProductClass, ProductWeight, ProductStyle,…
A: SELECT Statement:The query begins with the SELECT keyword, indicating that we want to retrieve…
Q: Answer: 1.792e3 seconds
A: Estimated time t= 960 seconds.Explanation:Given the LU factorization time for a 300 x 300 matrix is…
Q: How and where do I exactly write the Java statements as indicated by the comments? It doesn't make…
A: Note - You have to write a Java statement in the form of a code, and it will be written under your…
Q: Below is a description of the business process of a hospital. After reading the business process…
A: An Entity-Relationship Diagram (ERD) is a visual representation of the data that will be captured by…
Q: 14) Which of the following is an advantage of a doubly linked structure over a singly linked…
A: 1) In a doubly linked structure, each node contains references to both its previous and next nodes.…
Q: Microsoft Access
A: To create a database named "Students" based on the template provided by Microsoft Access, you can…
Q: Is there a difference between 48:14ˆ2 and 48:(14ˆ2)?
A: In MATLAB, proper understanding of the order of operations when generating ranges is critical for…
Q: I am struggling with this problem because I don't understand how to do this. I don't know how to…
A: In the traditional sliding tile puzzle known as The Eight Puzzle, the player must rearrange the…
Q: Why is cyberattack issues are important for the organization
A: Cyberattack issues are important for an organization due to a multitude of reasons. The primary…
Q: in pythonString full_string is read from input. Assign sub_string with full_string starting at index…
A: The objective of the question is to extract a substring from a given string starting from a specific…
Q: Computer Forensics & Investigation What is disaster recovery plan? Why is it important?
A: A disaster recovery plan (DRP) is a reported, organized approach with predefined ventures for…
Q: How can cryptography be used to secure the lines of network communications between a remote worker…
A: The objective of the question is to understand how cryptography can be used to secure the network…
Q: ed help with MATLAB programming. I just want to add a straight line to all three directions in an…
A: You can use the plot3 function to add lines along each axis of an ellipsoid plot in order to add…
Q: A system is composed of CPU, Disk and Network. The execution of a process proceeds as follows: The…
A: In this question we have to design a queuing diagram for a system by understanding the system.Let's…
Q: Represent the decimal number 171.625 in 32-bit IEEE 754 format.
A: 0 10000110 01010111010000000000000SOLUTION -If we want to represent the decimal number 171.625 in…
Q: Our everyday number system in the UK and many other parts of the world is a base-10 system using…
A: Please refer below to get your python code.Explanation:Answer :: Code ->def base14_convert(s):…
Q: Write a MIPS program that takes three inputs from the user, two operands and an operator, and…
A: Here's the algorithm for the MIPS assembly software:Display the prompt asking the consumer to enter…
Step by step
Solved in 3 steps with 1 images
- Read a list of TV shows from a file named "Shows.txt" and store them in a Python list of dictionaries. Shows.txt: Breaking Bad, 2008, Drama, 9.5, Vince Gilligan Stranger Things, 2016, Sci-Fi, 8.7, The Duffer Brothers The Crown, 2016, Drama, 8.6, Peter Morgan Black Mirror, 2011, Sci-Fi, 8.8, Charlie Brooker Game of Thrones, 2011, Fantasy, 9.3, David Benioff and D. B. Weiss The Mandalorian, 2019, Action, 8.7, Jon Favreau The Witcher, 2019, Fantasy, 8.2, Lauren Schmidt Hissrich Output all the TV shows in your list. Output all TV shows released before the year 2015. Output all TV shows with a rating higher than 8.5. Calculate the average episode count of all TV shows in your list. Create a histogram of the genres of the TV shows. Each element in the histogram should represent the count of shows in a specific genre. Take all the TV shows in "Shows.txt" and store them in a Python set of tuples where each tuple represents (show title, release year). Output all unique creators of the TV shows.…The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionThe Directir file contains namés línhe employees and their phone numbers in the following order: Last name, First name, Phone. The creator of this file made several mistakes by typing commas and dots inconsistently. Write a Python program to read this file and produce an output file with the name DirectoryNew.txt. This file should format the phone directory as follows: Phone First name Number 1 First name 1 Number 2 First name 2 The file MUST end with: End of directory Edit Metadata Edit Metadata Content of the input file The output should be as follows Springsteen, Bruce, 2587. Hassan, Amir, 6958. Phone First name Homes, Rebecca, 5263 Smith, John, 5252 MacDonald, Mirna, 8965! Pichai, Sundar, 9632. Jobs, Steve, 1002 2587 Bruce 6958 Amir 5263 Rebecca 5252 John 8965 Mirna 9632 1002 Goldsmith, Micheal, 5478. Sundar Yassir, Ammar, 8885 Steve Nicholas, Jack, 4696 5478 Micheal 8885 Pang, Chee, 9898 Lee, Andrew, 7412. Jimenez, Dragos, 6547 Ammar 4696 Jack 9898 Chee 7412 Andrew 6547 Dragos…Create a program in C language for reading and writing student records. Submit all necessary source codes and files to run this program (it is recommended to compress all files and submit a single file). First create text file "student_records.txt". The file should look like: Name Surname Quiz 1 Quiz 2 Quiz 3 Ada Lovelace 93 88 97 Babbage Turing Нopper Charles 26 80 70 Alan 74 85 92 Grace 99 87 100 a. Read the file contents and load them into an array of Record structs. b. The record struct has the member variables: o char array name o char array surname o int quiz_1 o int quiz_2 o int quiz_3 c. Write a function that calculates a students quiz average. The function takes a Record struct and returns a double. d. Create two new records for students inside your main program. e. Create a new text file with the new records to a a file called "student_records_new.txt"
- In python please Lab: Faculty Salaries 1. Create a data file, called salary.txt, with 100 lines. 2. Each line in the file consists of a faculty:a. First nameb. Last namec. Rankd. Salary 3. For the first and last name use:ith line FirstNamei and LastNamei 4. The rank is randomly generated as assistant, associate, and full. 5. The salary is randomly generated as a number with two digits after the decimal point. a. Assistant Professor 50,000 – 80,000b. Associate Professor 60,000 – 110,000c. Full Professor 75,000 – 130,000 6. Sample data:FirstName1 LastName1 assistant 59125.75 FirstName2 LastName2 full 112800.25...FirstName100 LastName100 associate 89355.23 7. Using salary.txt that you created, write a program to display the following: a. Total salary for assistant professor, associate professor, and full professor b. Average salary for each.PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.Write a python program that does the following: Reads information from a text file into a list of sublists. Be sure to ask the user to enter the file name and end the program if the file doesn’t exist. Text file format will be as shown, where each item is separated by a comma and a space:ID, firstName, lastName, birthDate, hireDate, salary Store the information into a list of sublists called empRoster. EmpRoster will be a list of sublists, where each sublist contains the information for one employee.The birthDate and hireDate in file are strings, but should be stored as objects of type Date.Example of EmpRoster list with 2 employees:[ [111,”Joe”, “Jones”, “09-01-1980”,”10-19-1999”, 95000], \ [222, “Sam”, “Smith”, “07-10-1956”,, “01-01-2000”, 50000] ] Print a report that shows the following: Employee RosterID First Name Last Name Birth Date Age Hire Date YrsWorked Salary WRITE the following information out to a…
- Follow these steps:● Create a new Python file in this folder called float_manipulation.py● You will need to import the math module and use its built-in functions tocomplete this task.● Write a program that starts by asking the user to input 10 floats (these canbe a combination of whole numbers and decimals). Store these numbersin a list.● Find the total of all the numbers and print the result.● Find the index of the maximum and print the result.● Find the index of the minimum and print the result.● Calculate the average of the numbers and round off to 2 decimal places.Print the result.● Find the median number and print the result.This is a Python program Reads information from a text file into a list of sublists. Be sure to ask the user to enter the file name and end the program if the file doesn’t exist. Text file format will be as shown, where each item is separated by a comma and a space:ID, firstName, lastName, birthDate, hireDate, salary Store the information into a list of sublists called empRoster. EmpRoster will be a list of sublists, where each sublist contains the information for one employee.The birthDate and hireDate in file are strings, but should be stored as objects of type Date.Example of EmpRoster list with 2 employees:[ [111,”Joe”, “Jones”, “09-01-1980”,”10-19-1999”, 95000], \ [222, “Sam”, “Smith”, “07-10-1956”,, “01-01-2000”, 50000] ] Print a report that shows the following: Employee RosterID First Name Last Name Birth Date Age Hire Date YrsWorked Salary WRITE the following information out to a text file – ask the…How to search for a user from the text file using the user id and then let the program display the user's details. The program should display the user's details as follows: user_id, first_name, last_name, gender, age, phone, and address. C++ coding using a doubly-linked list.