1. Read a list of fictional characters from a file named "Characters.txt" and store them in a Pythonlist of dictionaries.Characters.txt:"Harry Potter", "Harry Potter series", "J.K. Rowling""Frodo Baggins", "The Lord of the Rings series", "J.R.R. Tolkien""Sherlock Holmes", "Sherlock Holmes series", "Arthur Conan Doyle""Lara Croft", "Tomb Raider series", "Core Design""James Bond", "James Bond series", "lan Fleming""Katniss Everdeen", "The Hunger Games series", "Suzanne Collins"1. Output all the fictional characters in your list.2. Output all characters created by J.K. Rowling.3. Output all characters from book series.4. Count how many characters are from the "Harry Potter" series.5. Create a histogram of the authors. Each element in the histogram should represent the count ofcharacters created by a specific author.6. Take all the characters in "Characters.txt" and store them in a Python set of tuples where eachtuple represents (character name, book/series, author).7. Output all unique book series represented among the characters.8. Output the total number of entries in your set.

In this question we have to write a python code for the fictional character from a given characters…

1. Read a list of fictional characters from a file named "Characters.txt" and store them in a Python list of dictionaries. Characters.txt: "Harry Potter", "Harry Potter series", "J.K. Rowling" "Frodo Baggins", "The Lord of the Rings series", "J.R.R. Tolkien" "Sherlock Holmes", "Sherlock Holmes series", "Arthur Conan Doyle" "Lara Croft", "Tomb Raider series", "Core Design" "James Bond", "James Bond series", "lan Fleming" "Katniss Everdeen", "The Hunger Games series", "Suzanne Collins"

1. Read a list of fictional characters from a file named "Characters.txt" and store them in a Python list of dictionaries. Characters.txt: "Harry Potter", "Harry Potter series", "J.K. Rowling" "Frodo Baggins", "The Lord of the Rings series", "J.R.R. Tolkien" "Sherlock Holmes", "Sherlock Holmes series", "Arthur Conan Doyle" "Lara Croft", "Tomb Raider series", "Core Design" "James Bond", "James Bond series", "lan Fleming" "Katniss Everdeen", "The Hunger Games series", "Suzanne Collins"

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Read a list of TV shows from a file named "Shows.txt" and store them in a Python list of dictionaries. Shows.txt: Breaking Bad, 2008, Drama, 9.5, Vince Gilligan Stranger Things, 2016, Sci-Fi, 8.7, The Duffer Brothers The Crown, 2016, Drama, 8.6, Peter Morgan Black Mirror, 2011, Sci-Fi, 8.8, Charlie Brooker Game of Thrones, 2011, Fantasy, 9.3, David Benioff and D. B. Weiss The Mandalorian, 2019, Action, 8.7, Jon Favreau The Witcher, 2019, Fantasy, 8.2, Lauren Schmidt Hissrich Output all the TV shows in your list. Output all TV shows released before the year 2015. Output all TV shows with a rating higher than 8.5. Calculate the average episode count of all TV shows in your list. Create a histogram of the genres of the TV shows. Each element in the histogram should represent the count of shows in a specific genre. Take all the TV shows in "Shows.txt" and store them in a Python set of tuples where each tuple represents (show title, release year). Output all unique creators of the TV shows.…
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse python
The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
The Directir file contains namés línhe employees and their phone numbers in the following order: Last name, First name, Phone. The creator of this file made several mistakes by typing commas and dots inconsistently. Write a Python program to read this file and produce an output file with the name DirectoryNew.txt. This file should format the phone directory as follows: Phone First name Number 1 First name 1 Number 2 First name 2 The file MUST end with: End of directory Edit Metadata Edit Metadata Content of the input file The output should be as follows Springsteen, Bruce, 2587. Hassan, Amir, 6958. Phone First name Homes, Rebecca, 5263 Smith, John, 5252 MacDonald, Mirna, 8965! Pichai, Sundar, 9632. Jobs, Steve, 1002 2587 Bruce 6958 Amir 5263 Rebecca 5252 John 8965 Mirna 9632 1002 Goldsmith, Micheal, 5478. Sundar Yassir, Ammar, 8885 Steve Nicholas, Jack, 4696 5478 Micheal 8885 Pang, Chee, 9898 Lee, Andrew, 7412. Jimenez, Dragos, 6547 Ammar 4696 Jack 9898 Chee 7412 Andrew 6547 Dragos…
Create a program in C language for reading and writing student records. Submit all necessary source codes and files to run this program (it is recommended to compress all files and submit a single file). First create text file "student_records.txt". The file should look like: Name Surname Quiz 1 Quiz 2 Quiz 3 Ada Lovelace 93 88 97 Babbage Turing Нopper Charles 26 80 70 Alan 74 85 92 Grace 99 87 100 a. Read the file contents and load them into an array of Record structs. b. The record struct has the member variables: o char array name o char array surname o int quiz_1 o int quiz_2 o int quiz_3 c. Write a function that calculates a students quiz average. The function takes a Record struct and returns a double. d. Create two new records for students inside your main program. e. Create a new text file with the new records to a a file called "student_records_new.txt"
In python please Lab: Faculty Salaries 1. Create a data file, called salary.txt, with 100 lines. 2. Each line in the file consists of a faculty:a. First nameb. Last namec. Rankd. Salary 3. For the first and last name use:ith line FirstNamei and LastNamei 4. The rank is randomly generated as assistant, associate, and full. 5. The salary is randomly generated as a number with two digits after the decimal point. a. Assistant Professor 50,000 – 80,000b. Associate Professor 60,000 – 110,000c. Full Professor 75,000 – 130,000 6. Sample data:FirstName1 LastName1 assistant 59125.75 FirstName2 LastName2 full 112800.25...FirstName100 LastName100 associate 89355.23 7. Using salary.txt that you created, write a program to display the following: a. Total salary for assistant professor, associate professor, and full professor b. Average salary for each.
PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.
Write a python program that does the following: Reads information from a text file into a list of sublists. Be sure to ask the user to enter the file name and end the program if the file doesn’t exist. Text file format will be as shown, where each item is separated by a comma and a space:ID, firstName, lastName, birthDate, hireDate, salary Store the information into a list of sublists called empRoster. EmpRoster will be a list of sublists, where each sublist contains the information for one employee.The birthDate and hireDate in file are strings, but should be stored as objects of type Date.Example of EmpRoster list with 2 employees:[ [111,”Joe”, “Jones”, “09-01-1980”,”10-19-1999”, 95000], \ [222, “Sam”, “Smith”, “07-10-1956”,, “01-01-2000”, 50000] ] Print a report that shows the following: Employee RosterID First Name Last Name Birth Date Age Hire Date YrsWorked Salary WRITE the following information out to a…
Follow these steps:● Create a new Python file in this folder called float_manipulation.py● You will need to import the math module and use its built-in functions tocomplete this task.● Write a program that starts by asking the user to input 10 floats (these canbe a combination of whole numbers and decimals). Store these numbersin a list.● Find the total of all the numbers and print the result.● Find the index of the maximum and print the result.● Find the index of the minimum and print the result.● Calculate the average of the numbers and round off to 2 decimal places.Print the result.● Find the median number and print the result.
This is a Python program Reads information from a text file into a list of sublists. Be sure to ask the user to enter the file name and end the program if the file doesn’t exist. Text file format will be as shown, where each item is separated by a comma and a space:ID, firstName, lastName, birthDate, hireDate, salary Store the information into a list of sublists called empRoster. EmpRoster will be a list of sublists, where each sublist contains the information for one employee.The birthDate and hireDate in file are strings, but should be stored as objects of type Date.Example of EmpRoster list with 2 employees:[ [111,”Joe”, “Jones”, “09-01-1980”,”10-19-1999”, 95000], \ [222, “Sam”, “Smith”, “07-10-1956”,, “01-01-2000”, 50000] ] Print a report that shows the following: Employee RosterID First Name Last Name Birth Date Age Hire Date YrsWorked Salary WRITE the following information out to a text file – ask the…
How to search for a user from the text file using the user id and then let the program display the user's details. The program should display the user's details as follows: user_id, first_name, last_name, gender, age, phone, and address. C++ coding using a doubly-linked list.