1. Give two examples of how Canil et al's study lacks ecological validity. 2. A feature of laboratory experiments is that the researcher has control over the situation and can standardize their procedure. Give four examples of controls in this experiment.

Q: A lawyer sets out to prove that a child with type A blood is the son of a man wi type B blood and a…

A: The blood group of an individual is determine by the alleles which determines the type of antigenic…

Q: Moving to another question will save this response. Question 10 This plant community covers about…

A: Introduction :- A wetland is a unique environment that experiences seasonal or constant flooding…

Q: Determine the correspondence of the gene X and gene Y to the mutant gene causing Trp-phenotype

A: An organism's genotype is influenced by its genome as well as by its environment. The physical…

Q: The first step of β oxidation is: hydration by enoyl CoA hydrase. oxidation by FAD. activation by…

A: Beta oxidation In metabolism, this process is the catabolic process through which molecules of fatty…

Q: What surves as a long-term storage area for water or nutrients

A: Introduction: Water storage is a broad term that encompasses both potable water for human use and…

Q: about two Practice Practice creating a dihybrid cross are dominan characteristics in pea plants,…

A: Dihybrid cross: - A Dihybrid cross is defined as a cross between two individuals who differ in two…

Q: A method which can prevent oral purge when shipping by air is to___. ligate the trachea keep a…

A: Introduction The lungs are two paired structures involved in respiration. They are situated in the…

Q: ➤ Question 22 3 points Save Answer A plant has the following characteristics: a taproot system,…

A: Introduction  The kingdom Plantae contains eukaryotes that are mostly photosynthetic. Algae and…

Q: 5. When given images such as the ones below, be able to identify the specific type of cell transport…

A: Transport of various particles and molecules across the cell is very important for the proper…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: In endosymbiotic theory, host cells were believed to have ingested smaller individual photosynthetic…

A: Endosynotic theory is a theory which explains the evolution of a Eukaryotic cell from a primitive…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" =  5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: The image above was taken using a 40x objective lens in our MoCell lab with 2.5 calibration factor.…

A: A microscope is an instrument that can be used to observe the small objects like, cells. The image…

Q: List and describe the processes that make up the central dogma of biology which provides the path…

A: Central dogma is the process in which the genetic information flows from DNA to RNA, to make a…

Q: Compare negative feedback and positive feedback. Practice with this online interactive activity.…

A: The endocrine system is a small set of glands distributed throughout the body, including the pineal,…

Q: Different between fruit and seed

A: Fruit and seeds are formed as a result of reproduction in plants. Seeds are found in both…

Q: population, and the number of mating events for both islands. Graph 2: Number of Iguana Mating…

A: Marine iguana usually have no inter-specific as well as intra-specific competition for the food.…

Q: Compare the number and type of chambers found in fish, toad and human hearts – how do they differ?…

A: Humans and the majority of other animals depend on their hearts to stay alive. Examining the…

Q: THREE WAYS IN WHICH YOU COULD APPLY THE CONCEPT - As energy flows through ecosystems in food chains…

A: The amount of energy available to organisms at each level in a food chain or web decreases as the…

Q: Explain how genetic evidence from the Neanderthal genome helps paleoanthropologists understand their…

A: While DNA can be used to understand aspects of biology and evolution, the fact that DNA is a fragile…

Q: listed

A: Yes, The first letter in Key A goes with the letter B.  Number 11 is LH hormone, means Luteinizing…

Q: Select all that apply. Amino acid synthesis is generally regulated by:

A: Amino Acids are the monomeric units of proteins. They contain a carboxyl group and an amino group.

Q: Is covid still a global threat

A: The virus that causes severe acute respiratory syndrome coronavirus 2 is the source of the…

Q: Choose the CORRECT sequence of glycine formation. transamination of 3-phosphoglycerate → hydrolysis…

A: Glycine It is an amino acid which is the building block for generating proteins in the body. It has…

Q: What have you observed regarding the brightness of the light field when the objectives were shifted…

A: Introduction  A laboratory tool called a microscope is used to look at things that are too small to…

Q: In 2017, 16 bison were released into Elk Island National Park. Within the next five years, 42 more…

A: Introduction :  The speed at which new members are added to the population per capita is referred to…

Q: What leads to teenage pregnancy

A: Introduction: Adolescent pregnancy is a worldwide problem, although it most frequently affects…

Q: Determine the advantages of phage therapy over antibiotict herapy.

A: Bacteriophage therapy (BT) is another name for phage therapy (PT). It treats bacterial infections…

Q: CD4 is O The receptor protein on some immune cells that allows HIV to recognize its host cell The…

A: AIDS is most severe form of HIV infection.The transmission of HIV requires contact with a body fluid…

Q: Determine the justification for variation in the phenotypic expression of MERRF in identical twins.

A: Myoclonus Epilepsy with Ragged-Red Fibers Syndrome, often known as MERRF, affects the neurological…

Q: How would you explain cytoplasmic determinants to a 5 year old?

A: Developmental biology is the field of study that focuses on understanding how several interrelated…

Q: give me a diagram of plant and animal cell diagram under light microscope

A: Cell is a structural and functional unit of life. On the basis of the structure cell can be divided…

Q: 1. You are a research assistant in a renowned science academy. Your supervisor requires you to…

A: PCR:- it is used to amplify the fragments of a DNA or gene of interest.  Gene cloning:- it is a…

Q: What 8 things are required to maintain life?

A: Introduction Biology is the science that investigates life. This may appear to be a foolish question…

Q: 2. Identify the following structures when given images such as the ones below:

A: Process of Translation :- Translation is the process by which the genetic code contained within a…

Q: Which best describes conjugation in bacteria? OA. Bacteria take DNA from their environment. B.…

A: Gene transfer is the movement of genetic information between organisms. It can be horizontal or…

Q: What structural and biochemical changes does the spermatid undergo during permiogenesis? How do…

A: spermiogenesis is the final stage of spermatogenesis that involves maturation of spermatids into…

Q: Explain why Asian elephants and woolly mammoths share a more recent ancestor than they do with…

A: Evolutionary studies has taken many leaps in the last few decades, as the techniques in molecular…

Q: Answer the following questions related to bias in screening studies. A- Explain in your own word,…

A: Lead time:- it is the time duration between the detection of a disease via screening or any…

Q: .  What is the function of the blood cell? A.  Carry messages all over the body B. to control the…

A: Introduction: Red blood cells (RBC), white blood cells (WBC), and platelets are the three different…

Q: QUESTION 21 Suppose that in a population the frequency of a particular recessive condition is 1/400.…

A: According to Hardy Weinberg's equilibrium p2 + q2 + 2pq=1 and p + q= 1 Where, p= frequency of the…

Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…

A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…

Q: Determine the site of the occurrence of mutation in the promote that prevents the binding of RNA…

A: The key component of the operon's promoter region is an RNA polymerase binding site that serves as…

Q: Determine the advice that a genetic counsellor can give to the parents about MERFF that might…

A: The illness known as myoclonus epilepsy with ragged red fibres, or MERFF, is brought on by a…

Q: what is mitosis

A: Cell division is a metabolic phenomenon takes place inside the cell in which parent cell undergo…

Q: Weighing gold fish prior to conducting experiments on them is done ...

A: Introduction Metabolism is the process by which living organisms obtain energy to drive their…

Q: 4. The diagram below shows the process of protein synthesis. Label the numbered parts of the…

A: This picture represent the translation process which is the formation of polypeptide chain from…

Q: 2 3 4

A: When when a growth of particular Organism or population is recorded and represented in graphical…

Q: Select all the correct answers. When doing medical research with human subjects, which four…

A: Medical research involves research in a wide range of fields, such as biology, chemistry,…

Q: So yes?

A: Restriction enzyme that cuts double-stranded DNA into fragments after recognizing specific…

Communities and Ecosystems

Ecology contains two words: Eikos means dwelling, and logy means to study, so the combined meaning is studying habitat or living.