1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?
Q: What are the factors that cause mutation?
A: Mutation is a spontaneous molecular change in the DNA sequence of a gene. There are different types…
Q: It is known that the second amino acid in that protein is argınine, and if we zoom in and look in…
A: The coding strand is the sense strand of the DNA double helix that has the polarity of 5'--> 3'…
Q: What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous…
A: DNA methylation is the process of adding methyl groups to DNA at Nucleotide bases, so that without…
Q: What is the purpose of precipitation?
A: 1. DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: explain how to do you identify which mutation is happening when given a sequence?
A: Mutation can arise during replication, recombination which can cause permanent change in the…
Q: What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is composed of…
Q: What is the long term and short term effects of mutation on coding and non-coding DNA, the amount of…
A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…
Q: Which of the following is an example of a beneficial mutation?
A: Some mutations have positive effect on organism in which they occur are called beneficial mutations.…
Q: How can we estimate the age of a mutation?
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. Mutation occurs…
Q: Why is a random mutation more likely to be deleterious than beneficial?
A: Mutations are sudden negative effects in DNA sequences that can occur when the DNA is in the…
Q: Suppose researchers learn that a particular congenital disease is caused by synthesis of a protein…
A: Recombinant DNA technology brings the the gene from multiple sources together and place it in the…
Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?
A: Human Genome is comprised of only 1.1% exons of the total, whereas 24% is in introns, and the…
Q: Which type of mutation has the nighest mutation rate?
A: A mutation is a change in our DNA sequence that occur as a result of errors in DNA copying or…
Q: What is Central Dogma of Molecular Biology?
A: The organisms that contain DNA as a genetic material shows a fascinating process within the cell is…
Q: What is a driver mutation?
A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…
Q: Provide one example of a clinical implication of a “silent mutation” that proven to have an effect…
A: Answer: SILENT MUTATIONS are the mutations in the DNA that do not have an observable effect on the…
Q: Define FOUR (4) types of point mutations within coding sequences
A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…
Q: Why do frameshift mutations tend to have a more severe consequence than a missense mutation?
A: Mutation is change in a DNA sequence. Mutations can result from: DNA copying mistakes made during…
Q: How does a mutagen induce mutation ?explain with examples?
A: The DNA is a genetic material- a polynucleotide chain made up of the long chain of A, T, G, and C.…
Q: Approximately what portion of the human genome is composed of repeat sequences?
A: According to the results found in the human genome studies it is seen that the human genome has…
Q: How many different explanations can you think of for the observation that the rate of mutation…
A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…
Q: What is the likely consequence of a frameshift mutation?
A: A mutation occurs/happens when the sequence/structure of DNA is altered. Mutations can occur as a…
Q: Provide one example of a clinical implication of a “silent mutation” that has proven to have an…
A: Natural selection is an evolutionary mechanism and organisms that are more environmentally suited…
Q: What is a gene? Provide at least two different definitons and explain.
A: DNA contains gene that has genetic information and passes to the next generation. The functional…
Q: Which of the following statements about a transversion mutation in the sequence AGC is true?
A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…
Q: What is the resulting polypeptide: _______________________________________________________? What…
A: Central dogma is the central processing part in which DNA is converted into m RNA by transcription…
Q: Among the different types of amino acid substitution (same sense, missense, or nonsense mutations),…
A: Introduction A mutation is a change in the DNA sequence of an organism, either as the result of…
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias?
A: Hi! Thanks for the questions. As you have posted multiple questions, I will be answering the first…
Q: TACAT
A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions.
Q: Basic features of the central dogma of molecular genetics is
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: What are the chances of occurence of amorphic mutation?
A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…
Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?
A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .
Q: What is the minimal number of insertions/deletions of nucleotides that would result in a frameshift…
A: A mutation happens when a DNA (deoxyribonucleic acid) gene is broken or modified causing the change…
Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?
A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…
Q: If the GAATTC palindrome repeats are randomly found along the DNA strand, then what can you say…
A: *If the GAATTC palindrome repeats found along the DNA strand then some sizes of the fragments that…
Q: How do we know that DNA synthesis is discontinuous on one of the two template strands?
A: DNA replication refers to the process of making two identical copies of a DNA molecule. This…
Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…
A: Central Dogma of Biology: The flow of genetic information from DNA to RNA which is…
Q: What is a genome and what is it composed of? What is thecentral dogma of molecular biology?
A: Genes are the hereditary units that are transmitted from one generation to another generation. The…
Q: Why are frameshift mutations likely to be more detrimental than point mutations, in which a single…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in?…
A: In genetic code a unit known as codon, which codes for amino acid. For example the sequence AUG is a…
Q: How would one recognize a gap in the genome sequence following nucleotide sequencing?
A: DNA is made up of four bases namely adenine (A), thymine (T), cytosine (C), and guanine (G). The…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Step by step
Solved in 4 steps with 1 images
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages provideanswers for the following questions?1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. answers for the following questions?2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. 1) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'Define and compare the outcomes of the following types of nucleotide substitutions, insertion or deletions. Which is likely to cause the least dramatic mutant effect? a) missense mutations b) nonsense mutations c) frameshift mutations d) silent mutation
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'The following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…