Figure Facts Template_Bi221_Nematode Diversity_new2023 _ Paula Bertisan
.pdf
keyboard_arrow_up
School
Oregon State University, Corvallis *
*We aren’t endorsed by this school
Course
221
Subject
Biology
Date
Dec 6, 2023
Type
Pages
4
Uploaded by paulabertisan on coursehero.com
Figure Facts and Experimental Design Outline
Name: Paula Bertisan
Feel free to discuss the primary research paper with your peers, but you must write and hand
in your own assignment. In all cases, write your answers in your own words and create your own
drawings. Do not copy sentences or images from the primary research paper (or from your
friends!). As a rule of thumb, no more than five consecutive words from the primary research
paper should appear in your assignment unless specified.
Part 1: Figure Facts
In this section, we will examine the primary research paper through an analysis of the
introduction and figures. Fill out the table below and keep your responses brief (1 sentence
and/or bullet point form is fine.) There is an example in the table below.
You must write
something about each figure to get credit for this section.
Write an Article Citation here:
Kergunteuil, Alan, et al. “The Abundance, Diversity, and Metabolic
Footprint of Soil Nematodes Is Highest in High Elevation Alpine Grasslands.”
Frontiers
, Frontiers, 6 July
2016,
www.frontiersin.org/articles/10.3389/fevo.2016.00084/full
.
1
2
Part 1. Read the Abstract and/or Introduction to find the following:
Broad Topic: Nematode Diversity across elevation gradients.
Specific Topic: How dose nematode diversity and functional group diversity change from low to high
elevations in the alps, and how the variations of soil food webs impacted the population of nematodes at
differen elevations.
What was known prior to this paper: What nematodes are, certain language such as scientific wording like
abundance, and population, where the study was taking place.
Experimental Question: How does elevation in the Alps affect the nematode community and their
functional diversity?
Part 2. Interpreting Figures 1,2, and 5:
Start by trying to interpret the figures using the information
present in the image and figure legends (a really good figure should be interpretable on its own). Then, if
that is not useful enough information, look in the text of the Results/Discussion for further explanation,
rather than the Methods section, as the Methods may be too technical to be easily understood.
(Google/Wikipedia may help!)
If, despite your best efforts, you are unable to understand all or part of the figure, write in one or
more of the questions you have about that figure/figure panel.
Figure
Number
Panel
if any
–
these are sub-figures
usually labeled A, B, C
Technique:
Broad description
of methods
eg. Determine the impact
of sunscreen exposure on
aiptasia health
These data show:
Summary of
Explanatory and
response variables.
eg How many aiptasia survived
(response var) when exposed to
sunscreen (explanatory)
These data mean:
Brief statement of the
results
eg Aiptasia health decreased
significantly after sunscreen exposure
Panel
Technique:
These data show:
These data mean:
Count of Total
Number of
Nematodes
The total number of
nematodes per 100 g
of dry soil at each
elevation transect
Total nematode abundance
increases with elevation so
there are more total
nematodes are higher
elevations.
Fig. 1
(A-C)
A- Elevation's
impact
B-Number of
nematodes in all.
Ratio of
nematophagous
fungus infestation
A-Nematode
counts and
elevation
comparisons were
made.
B-Simpsons index
in relation to
altitude
A- According to the
data, nematodes
multiply as elevation
rises, with the Faido
and Salgesh forms of
nematodes being the
most prevalent at
higher elevations.
B-As the elevation
increases, nematodes
Since the nematode
population rises with height,
there are more nematodes at
higher elevations.
Additionally, the quantity of
infected nematophagous
fungus decreases with
elevation, hence higher
elevations have fewer
infected nematophagous
fungi.
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
- Access to all documents
- Unlimited textbook solutions
- 24/7 expert homework help
Related Questions
INSTRUCTIONS:
Please do not copy here in Bartleby or in Google.
QUESTIONS :
1. What is the importance of the aseptic technique? Explain.
arrow_forward
Topic:
Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors)
Question
What are the drawbacks/disadvantages/unknowns associated with this genetic process?
arrow_forward
For letter A, pls ILLUSTRATE (create an illustration or drawing) the DILUTION SERIES of the problem just like the sample on the 2nd image.
Please read the instructions carefully as I have already posted this twice and the experts just copy-pasted the answers from my first post. I don't want to waste another post question for this one. Again, I NEED AN ILLUSTRATION and not just the computation/explanation through words so I can properly visualize the problem.
WILL UPVOTE if I get what I need.
arrow_forward
Topic:
Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors)
Question
When or why is this genetic technology/process used? Who benefits from this genetic technology/process - and how?
arrow_forward
Directions: Please provide 3-4 sentences giving a brief description of how your
experiment could be impaired or improved with the following modifications. Answer each
question to the best of your ability.
arrow_forward
Horizontal sequence :RIVL
Vertical sequence:FMK
Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below.
SW algorithm.
1. Complete the scoring matrix.
Scoring matrix with PAM250 scores:
R
I
V
L
F
M
K
2. Set up, initialize and complete the SW matrix.
3. Retrace, align and score alignment(s).
Use the arrows and circles for the matrix and path(s).
R
I
V
L
F
M
K
Align and score all optimal alignments here.
PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment
Here the following points…
arrow_forward
Which sequence variations are identified by NGS and in which format they are
store
Discuss in details the software used to identify the effect or nature of these variants.
How this information can be used for personalized medicine.
arrow_forward
Lifespan development science has two primary research designs – longitudinal and cross-sectional. Explain each of them, discussing the strengths and limitations of each. Explain how these two designs can be combined for a third research strategy – cross-sequential design.
arrow_forward
Discuss the importance of not coding a procedure directly from the Alphabetic Index.
Explain the effect of following the CPT guidelines when choosing codes.
arrow_forward
Think of a possible safety or ethical issue related to genetic engineering and discuss briefly (in 3-5 sentences) why this is a valid concern. Write your answer on the space provided below.
arrow_forward
PLEASE USE ATTACHED PROGRAM
Analyze the program using the FITT principle and the PROS concepts (write out what each letter stands for and then write what the program does/does not include as it relates to that particular principle).
Write out the stated "goal of the program you chose. Is this program designed in a manner to actually achieve its stated goal. Provide evidence to justify your answer.
Make recommendations about what you would change about the program in order to make it better adhere to the FITT principle and PROS concepts and to help it meet its stated goal.
Use the heart rate reserve method to calculate what YOUR target heart rate during exercise would be if you followed the recommended training program
arrow_forward
Instruction: Perform BLAST to identify the sources of the three (3) DNA sequences. Provide the
information being asked.
Species A:
ATGTTCACCGACCGCTGATTATTCTCTACAAACCATAAAGATATTGGAACACTATATCTA
CTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCCCTAAGTCTCCTTATTCGAGCAGAA
CTTGGTCAACCAGGCAACCTTCTAGGTAACGATCACATCTATAATGTTATCGTCACAGCC
CATGCGTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACT
GGCTAGTACCCTTAATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAA
GCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTGCTCGCATCCGCTATAGTAGAAGCCGG
CGCAGGGACTGGTTGGACAGTCTACCCTCCCTTAGCAGGAAATTATTCCCACCCCGGAGC
TTCTGTAGACCTAACCATTTTTTCCCTACACCTAGCAGGCATCTCCTCTATTCTAGGGGCC
АТСААСТТСАТТАСААСААТСАТСААТАТААAАССССССGCСАТААСССААТАССАААСА
ССССТТTТCGTCTGATCCGTOССТААТСАСАGCAGTCTTACTСТТСТАТСТСТСССAGTACT
AGCTGCTGGAАТТАССАТАТТАТТААСAGACGTAACСТСААСАССАCСТТTTCGACCC
AGCCGGAGGAGGAGATCCTATCCTATACCAACACTTATTCTGATTTTTTGGACACCCCGA
AGTTTACATTCТААТССТАССАGСCTTCGGAATAAТСТСССАСАТТGTAACTTATTACTС
GGAAAAAAAGAACCATTCGGATATATAGGTATAGTCTGAGCTATAATATCAATTGGTTTC…
arrow_forward
How will the information required to describe your RFP be obtained? Which kinds of methods are you going to employ?
lab intro attached if needed
arrow_forward
Identify the role of precision and data management (statistical analysis) in biomedical research?
Give typing answer with explanation and conclusion
arrow_forward
Is the identified issue truly an ethical concern? Are there other potential ethical concerns?
Do you agree with the observations about how the research study is being conducted and the possible issues involved?
How would you recommend addressing the potential ethical issues in the study?
This study analyzed the research trends in the field of digital twins by examining metadata from 9639 peer-reviewed articles published between 2000 and 2023. We processed the metadata using an NLP-based toolkit and manually labeled each article with its most relevant application field. Using the KCN methodology, we performed temporal research trend analysis, mapping popular sensing technologies to six application fields and identifying representative examples of digital twins in each field. For researchers, this analysis provides a comprehensive view of the field's development, identifying key areas for future exploration. For architects, the findings highlight technological applications and…
arrow_forward
INSTRUCTION: Write 1 if it's a PURE research and 2 if it's an APPLIED research.
NOTE: (no need for explanation)
Treat Systemic Lupus Erythematosus (SLE)
An investigation into the symptoms of Coronavirus.
A research to discover the components of the human DNA.
Should vaccinations be avoided to prevent autism?
Is genetically modified food hurting health?
Is modern technology creating a & quot; dumbing down & quot; of individuals?
How do slime molds reproduce?
What is the specific genetic code of the fruit fly?
How does tobacco use in various forms affect humans?
An investigation into the causative factors of malaria.
arrow_forward
Describe the Lidcombe program.
arrow_forward
The disease I have chosen to research is Parkinson's disease. find three (3) citations that could be used for this topic.
Annotate each of these citations with a separate 5-sentence paragraph, including the following information:
Description of the source and author: Are they reliable and valid? [1 sentence]
Description of findings that may be important to your project. [2–3 sentences]
Include the reason why you chose the source. How will it support your project? [1 sentence]
arrow_forward
The disease I have chosen to research is Parkinson's disease. find three (3) citations that could be used for this topic.
Annotate each of these citations with a separate 5-sentence paragraph, including the following information:
Description of the source and author: Are they reliable and valid? [1 sentence]
Description of findings that may be important to your project. [2–3 sentences]
Include the reason why you chose the source. How will it support your project? [1 sentence]
The first 3 were already done I need another 3 citations please!
arrow_forward
Narrative of your experiences of research in daily life.
Kindly answer please. Badly needed
arrow_forward
Topic:
Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors)
Question
Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?
arrow_forward
SEE MORE QUESTIONS
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Related Questions
- INSTRUCTIONS: Please do not copy here in Bartleby or in Google. QUESTIONS : 1. What is the importance of the aseptic technique? Explain.arrow_forwardTopic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?arrow_forwardFor letter A, pls ILLUSTRATE (create an illustration or drawing) the DILUTION SERIES of the problem just like the sample on the 2nd image. Please read the instructions carefully as I have already posted this twice and the experts just copy-pasted the answers from my first post. I don't want to waste another post question for this one. Again, I NEED AN ILLUSTRATION and not just the computation/explanation through words so I can properly visualize the problem. WILL UPVOTE if I get what I need.arrow_forward
- Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question When or why is this genetic technology/process used? Who benefits from this genetic technology/process - and how?arrow_forwardDirections: Please provide 3-4 sentences giving a brief description of how your experiment could be impaired or improved with the following modifications. Answer each question to the best of your ability.arrow_forwardHorizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: R I V L F M K 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). R I V L F M K Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment Here the following points…arrow_forward
- Which sequence variations are identified by NGS and in which format they are store Discuss in details the software used to identify the effect or nature of these variants. How this information can be used for personalized medicine.arrow_forwardLifespan development science has two primary research designs – longitudinal and cross-sectional. Explain each of them, discussing the strengths and limitations of each. Explain how these two designs can be combined for a third research strategy – cross-sequential design.arrow_forwardDiscuss the importance of not coding a procedure directly from the Alphabetic Index. Explain the effect of following the CPT guidelines when choosing codes.arrow_forward
- Think of a possible safety or ethical issue related to genetic engineering and discuss briefly (in 3-5 sentences) why this is a valid concern. Write your answer on the space provided below.arrow_forwardPLEASE USE ATTACHED PROGRAM Analyze the program using the FITT principle and the PROS concepts (write out what each letter stands for and then write what the program does/does not include as it relates to that particular principle). Write out the stated "goal of the program you chose. Is this program designed in a manner to actually achieve its stated goal. Provide evidence to justify your answer. Make recommendations about what you would change about the program in order to make it better adhere to the FITT principle and PROS concepts and to help it meet its stated goal. Use the heart rate reserve method to calculate what YOUR target heart rate during exercise would be if you followed the recommended training programarrow_forwardInstruction: Perform BLAST to identify the sources of the three (3) DNA sequences. Provide the information being asked. Species A: ATGTTCACCGACCGCTGATTATTCTCTACAAACCATAAAGATATTGGAACACTATATCTA CTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCCCTAAGTCTCCTTATTCGAGCAGAA CTTGGTCAACCAGGCAACCTTCTAGGTAACGATCACATCTATAATGTTATCGTCACAGCC CATGCGTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACT GGCTAGTACCCTTAATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAA GCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTGCTCGCATCCGCTATAGTAGAAGCCGG CGCAGGGACTGGTTGGACAGTCTACCCTCCCTTAGCAGGAAATTATTCCCACCCCGGAGC TTCTGTAGACCTAACCATTTTTTCCCTACACCTAGCAGGCATCTCCTCTATTCTAGGGGCC АТСААСТТСАТТАСААСААТСАТСААТАТААAАССССССGCСАТААСССААТАССАААСА ССССТТTТCGTCTGATCCGTOССТААТСАСАGCAGTCTTACTСТТСТАТСТСТСССAGTACT AGCTGCTGGAАТТАССАТАТТАТТААСAGACGTAACСТСААСАССАCСТТTTCGACCC AGCCGGAGGAGGAGATCCTATCCTATACCAACACTTATTCTGATTTTTTGGACACCCCGA AGTTTACATTCТААТССТАССАGСCTTCGGAATAAТСТСССАСАТТGTAACTTATTACTС GGAAAAAAAGAACCATTCGGATATATAGGTATAGTCTGAGCTATAATATCAATTGGTTTC…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning