Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.2, Problem 1CC
Summary Introduction
To determine: The reason why HOTAIR binds to the target gene.
Introduction: HOTAIR (Hox transcript antisense intergenic RNA) is a type of ncRNA which has the function of gene repression through prevention of transcription of proteins. HOTAIR is encoded by a gene which is present in the HoxC gene cluster.
Summary Introduction
To determine: The reason why HOTAIR does not bind next to every gene.
Introduction: HOTAIR (Hox transcript antisense intergenic RNA) is a type of ncRNA which has the function of gene repression through prevention of transcription of proteins. HOTAIR is encoded by a gene which is present in the HoxC gene cluster.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn-
thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix
region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA
binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor
dimer is also shown.
reverse turn
trp helix 4
70
Trp
-Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-
Ile-
Prl
-Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-
Val-
Pri heilix
trp helix 5
80
90
Trp
Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala-
Prl
Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg-
Prl helix
For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site, (b) template strand, and (c) promoter.
Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine
residue in the transcribed protein. How will this mutation effect this protein?
a) Polarity before and after mutation:
b) Size of the region before and after the mutation:
c) Tertiary interaction you would expect with substrate:
d) Name an amino acid that the unaffected protein's methionine could interact:
Chapter 13 Solutions
Biology
Ch. 13.1 - Prob. 1CCCh. 13.2 - Prob. 1CCCh. 13.3 - Prob. 1EQCh. 13.3 - Prob. 2EQCh. 13.3 - Prob. 3EQCh. 13.3 - Effects of Non-coding RNAs on Translation and mRNA...Ch. 13.4 - Non-coding RNAs and Protein Sorting Core Skill:...Ch. 13.5 - Core Skill: Modeling The goal of this modeling...Ch. 13 - Prob. 1TYCh. 13 - Prob. 2TY
Ch. 13 - Prob. 3TYCh. 13 - Prob. 4TYCh. 13 - Prob. 5TYCh. 13 - Prob. 6TYCh. 13 - With regard to miRNAs and siRNAs, which of the...Ch. 13 - Cas1 and Cas2 proteins play a role during which of...Ch. 13 - Which of the following components bind to...Ch. 13 - Abnormalities in the expression of ncRNAs are...Ch. 13 - An ncRNA may have one or more of the following...Ch. 13 - What is RNA interference (RNAi)? Explain how the...Ch. 13 - Prob. 3CQCh. 13 - Prob. 1COQCh. 13 - Go to the PubMed website and search for non-coding...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give typing answer with explanation and conclusion a) List three eukaryotic gene expression mechanisms that do not occur in prokaryotes. For two of these, give specific examples and the functional outcomes. b) Describe what is meant by the term “RNA silencing”. c) Using diagrams, give two examples of RNA silencing mechanisms and indicate one difference.arrow_forwarda) State the functions of the subunits of RNA polymerase and describe transcription initiation. b)Draw a diagram to illustrate the lac operon and explain how it functions in the presence of, i) glucose and ii) lactose in the culture mediumarrow_forwardAnswer these questions concerning promoters. a) What role do promoters play in transcription? b) What is the common structure of bacterial promoter with respect to consensus sequences? c) Eukaryotic promoters are more variable than bacterial promoters. Why? d) What is the meaning of the term alternative promoter? How does the use of alternative promoters affect transcription?arrow_forward
- The “domain-swapping” experiment that grafts the Gal4 DNA-binding domain to the LexA activation domain generates a chimeric protein that will: A) bind to the Gal4 site. B) bindto the LexA site. C) activate transcription of the LexA gene. D) activate transcription of alleukaryotic genes. E) All of the answer options are correct.arrow_forwardYou were recently tasked with the responsibility of generating an aptamer that was capable of binding to protein K with high specificity. a) Describe how you would utilize methods such as SELEX to identify aptamer candidates with the desired property. b) Assuming that aptamer binding was dependent on the presence of a bound Mg2+ (no metal binding site on protein K) describe how you would account for this metal binding requirement in your SELEX workflow.arrow_forwardMeasure the uptake of leucine by epithetial cells of the mouse intestine. Measurements of the rate of update of L-leucine, D-Leucine, and L-valine , with and without Na+ in the assay were perform and yield different results (see table below). A) What can you conclude about the properties and mechanism of leucine transporter? B) Would you expect L-leucine uptake to be inhibited by Ouabain, which is a cardiac glycoside drug treatment?arrow_forward
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forward. Recall that the trp operon has a special leader sequence (trpL) between the operator and the structural genes that offers attenuation as a mechanism for regulation of gene expression. (A) Draw a diagram of a trpL region of the operon when tryptophan is abundant in the cell.Label the following features: the DNA, 5’ and 3’ polarity of the RNA, the regions 1, 2, 3,and 4 and poly-U of the RNA, the pair of Trp codons (UGG), the ribosome, and RNA-Pol,along with any stem-loop structure that would form under these conditions (B) In the above example, will the rest of the trp operon genes be expressed? Briefly describe your reasoning why or why not (C) The trp codons in region 1 of the trpL gene have mutated to cysteines (UGG to UGC). What will be the effect on attenuation gene regulation of the trp operon? Brieflyexplain your reasoning.arrow_forwardHow can the binding assay approach be utilized to match coding triplets with their amino acid counterparts?arrow_forward
- If the binding activity was purified, suggest two experimental approaches that could be taken to verify that this factor is in fact a transcription factor? Explain.arrow_forwardWhat is the receptor for the targeting sequence?arrow_forwardThe E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY