Wobble hypothesis indicates that: a. fatty acids are degraded 2 carbons at a time. O b. 16S-ribosomal RNA recognizes Shine-Dalgarno sequence of the mRNA and thus initiates protein synthesis. C. DNA replication is semi-conservative. d. the 5'base of anticodons may recognize 1, 2 or 3 bases in the codons and thus only 31 different tRNA molecules can recognize 61 codons. Oe. DNA replication proceeds bidirectionally.
Q: n oil obtained from salmon is unusual in that all three fatty acid components are identical. The…
A: Introduction Lipid is one of the important biomolecule in our body. Lipid is present in the plasma…
Q: You perform a succinate dehydrogenase (SDH) assay on the fractions the isolated fractions. You read…
A: The sixth step of the Tricarboxylic Acid (TCA) cycle is catalyzed by succinate dehydrogenase (SDH).…
Q: Which of the following enzymes is inhibited as a result of insulin binding to its receptor? glycogen…
A: Insulin regulates the level of blood glucose by stimulating the uptake of glucose from the blood…
Q: What is the name of this cofactor related to niacin? 0 O-P :0 U -ро OH -CH₂ Н Н OH NH₂ OH Н OH 2+…
A: Niacin is also known as vitamin B3. It is also known as nicotinic acid. It is a water soluble…
Q: Draw the complete electron pushing mechanism for the reaction.
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: RESULTS Table 1. Absorbance values of BSA standards. ● ● Test Tube No. BSA (μL) DDW (μL) 100 80 60…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Draw a lipid exhibiting both an ether-linked and ester-linked acyl group attached to a glycerol…
A: Lipids are made up of fatty acids. they are insoluble in water. Lipids are important constituents of…
Q: Which of the following is considered an omega-6 fatty acid?
A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…
Q: Be able to describe how the “law of mass action” drives bicarbonate formation when the blood is in…
A: In a reversible reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: Transcriptional initiation at defined sequences in DNA is required to ensure that the 5' end of the…
A: By forming a DNA-protein complex with a specific DNA binding protein, DNA regulatory sequences…
Q: Glucagon is a hormone that indicates low blood glucose. A. Where is glucagon generated and released…
A: Carbohydrates that are obtained through the diet are digested into monosaccharides such as glucose…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…
Q: Which of the following substances derived from lipid catabolism serves as a precursor for glucose…
A: Triglycerides are fatty acid esters of glycerol. Three fatty acids are esterified to a single…
Q: e) Draw a cartoon version of a lipid bilayer that illustrates the packing of several phospholipids…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Which of the following statements concerning D-glucose in INCORRECT? O a. It is a monosaccharide. O…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: A scientist is studying the enzyme X which is an important point of regulation in the metabolism of…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: In histones, there are high content of two residues: Lys and Arg, because these residues can a.…
A: One of the fundamental processes that keep living things functioning is controlled by DNA. They…
Q: AG" for reaction A B = -10 kJ/mol AG" for reaction BC = -8 kJ/mol AG" for reaction CD = 5 kJ/mol AG"…
A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…
Q: Defects in the Citrate Cycle are rare but have been described. Based on the level of metabolites…
A: Glycolysis consists of 10 enzymatically catalysed reactions that convert one 6-carbon molecule of…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: Identify which of the following pairs of amino acid residues can have hydrogen bonding between…
A: The three dimensional structure of a protein is necessary for attaining its functional form. The…
Q: BIOC 385 Biochemistry of Protein Synthesis Q11.4: Considering that binding of the correct tRNA to…
A: Translation is the process of protein synthesis. It occurs in the cytoplasm. Ribosomes have peptidyl…
Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…
A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: In order to study protein structures and functions, many protein techniques have been developed for…
A: There are various techniques in order to study about protein , whether be it's function or…
Q: A patient on dapsone begin to experience dizziness and vertigo 3 days after taking his medication.…
A: Cyanotic defects: Cyanosis is a condition caused by cyanotic defects, in which the blood pumped to…
Q: Find 3 reactions that facilitate the synthesis of oxaloacetate
A: The tricarboxylic acid cycle (TCA) is the metabolic pathway that generates NADH and FADH2 for…
Q: 1 enzymes are a class of proteins that catalyze biochemical reaction.what are ribozymes? 2 what is…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: H3N. Amino acids are bonded together in a linear polymer to form peptides or proteins. A small…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: “The binding of oxygen to hemoglobin exhibits positive cooperativity.” Explain briefly
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: 6. A control phospholipid membrane is isolated in which the phospholipid tails all have an 18-C…
A: Phospholipids are major membrane lipids and present as a bilayer structure. It is consist of…
Q: 1.How many chiral center does D-Eranose have? 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…
A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Q: The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose…
A: Phosphoglucomutase is the enzyme that catalyze the interconversion between glucose 1-phosphate (G1P)…
Q: A patient of African American decent came in due to vasooclusive symptoms, you suspect a condition…
A: Hemoglobin is a tetrameric protein that transports oxygen to the tissues and CO2 to the lungs. Each…
Q: 7. Specificity of membrane transporters. A protein that transports amino acids across the cell…
A: In competitive inhibition, the inhibitor competes with the substrate for binding at the active site…
Q: Beta oxidation generates substrates for cellular respiration through which of the following…
A: The body requires an ongoing flow of energy to carry out its functions. Several substrate molecules…
Q: po Which of the following non-covalent interactions is the driving force in the initial…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: How does insulin cause an increase in the rate of glucose transport into cells when blood glucose…
A: Insulin is a peptide hormone that helps to maintain the glucose levels in the blood. When there is…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Convert 475 cal to joules
A: Calories, joules are used to determine the amount of energy present in the food . The energy given…
Q: Several hours after a meal, the brain uses [Select] [Select] During starvation, the brain uses…
A: Carbohydrates are one of the three primary nutrients included in foods and beverages, along with…
Q: Given the Fischer projection structure of D-Lasallose below, show the step by step process of…
A: Given to us is a 7 carbon ketose sugar. We can number the carbon atoms as shown below. figure 1 The…
Q: One of the molecules listed below is effective in reducing O2 affinity of human Hb in the absence of…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino acids b. A protein/RNA complex that synthesizes protein c. A ribozyme that uses RNA as an enzyme to directly ligate free amino acids to tRNAs d. A multi-subunit protein complex that charges tRNA with amino acids 1.2 In RNA processing? A. Exons are added to the ends of mRNA for protection B. Intron sequences are removed before the mRNA is translated C. The RNA transcript that leaves the nucleus may be much longer than the original primary transcript D. All RNA transcripts will be processed and leave the nucleus.Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular tRNA. Based on this knowledge you know that a. This tRNA would be used to stop translation. b. This tRNA would carry the amino acid Serine to the ribosome. c. This tRNA would carry the amino acid Threonine to the ribosome. d. This tRNA would bind a TCA codon on DNA. e. This tRNA would not carry any amino acid to the ribosome. f. This tRNA would carry the amino acid Leucine to the ribosome.
- Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…49Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50Each bacterial mRNA open reading frame has its own ( ) codon. 51Two nuclear splicing intermediates resemble ______________. A.helicesb.lariatsc.hairpinsD.projectionsMatch Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
- Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding sequence) of one gene: 3’ CGC GGA TAT CTC GAG AAT TGT CTA 5’ x y z What is the structure of each of the following substances made under its direction? a. mRNAb. The polypeptide that is made using the given genetic information (use the genetic code)c. Suppose a mutation occurs, what is the resulting polypeptide sequence of the new DNA strand? 3’ CCC GAA TAT CTC GAG AAT TGT CTA 5’ x y z. Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a. 5’-CGATCTAATG-3’ b. 3’-TGCCGAGCTA-5’ c. 3’-GTAATCTAGC-5’ d. 3’-CATTAGATCG-5’ Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex pls answerIn regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs for codons. What would the consequences be if a cell lost the tRNA gene with the following anticodon sequences Please explain in depth A. 3'-ACA-5' B. 3'-CUG-5'
- What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.Genetic expression involves transcription and translation. Match the structure or molecule to the step. a. promoter region b. RNA polymerase c. antisense strand d. poly-A tail е. 5 саp f. splicing g. anticodon loop h. acceptor stem i. peptide bond j. A site 57. transcribed strand that will go on to translation 58. site where tRNA with amino acid enters the ribosome 59. intron sequences are removed and exons are combined together 60. site where amino acid combines with tRNA1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…