Which process is illustrated in the diagram? NAA 5' Replication Transcription RNA processing Translation Gene expression Search NNNNX 3 //\/ N 3' 99+ 85339 4) O
Q: Give typing answer with explanation and conclusion 1) A population of HIV viruses exposed to any…
A: The immune system, which is in charge of warding off illnesses and pathogens in the body, is…
Q: Draw and label a generalized cell cycle. Label: Interphase, Mitosis, Cytokiesis, G1, GO, G2,…
A: The cell cycle is the sequence of events that a cell goes through as it grows and divides into two…
Q: Give typing answer with explanation and conclusion to all parts The 5-FU metabolite F-dUTP is…
A: The 5-FU metabolites F-dUTP and F-dUMP are compounds that are relevant to the synthesis of DNA and…
Q: B. TIME SPENT IN EACH PHASE OF THE CELL CYCLE Table 14-1. Findings from time spent in each phase of…
A: The cell cycle describes the process by which cells grow, divide, and replicate. It is a highly…
Q: why when changing your diet, it's important to know how the cells in your body will react to the…
A: An extremely low-calorie diet (VLCD) is a diet that restricts daily calorie intake to between 500…
Q: Which process is illustrated in the diagram? ws Replication Transcription RNA processing Translation…
A: DNA replication is the process by which a cell duplicates its DNA before cell division. The…
Q: A 35 year old woman of Chinese ethnic background (Guangdong province) presented with a near normal…
A: Summary of results for each family member:
Q: Explain the activities associated with the isolation of Bacillus megaterium organsim from mixed…
A: Bacteria are single-celled microorganisms that are prokaryotic in nature, meaning they lack a…
Q: The DNA of each species has a different base composition. Find the base composition of each species,…
A: DNA, short for deoxyribonucleic acid, is a molecule that carries genetic information in cells. The…
Q: myofibril is only found in straight muscles. True or false
A: Muscles are specialized tissues that are responsible for producing force and movement in the body.…
Q: Use the terms DNA, RNA, codon, and protein to explain the connections between genetic information…
A: Genetic information refers to the hereditary material that is passed from one generation to the next…
Q: what are the Development and characteristics of acute lymphoblastic leukemia (including the…
A: Acute lymphoblastic leukemia (ALL) is a type of cancer that affects the white blood cells,…
Q: What process would cells need to depend on if they were in an anaerobic environment?
A: Anaerobic environment is the environment where oxygen is not present. Cells perform a specific type…
Q: regarding the USA population are also provided and will be used to determine the "Expected"…
A: According to Hardy Weinberg equilibrium, both allelic and genotypic frequency will remain the same…
Q: A biologist investigating enzyme function plotted the activity of a particular enzyme (y-axis) vs pH…
A: Enzymes are special proteins that help reactions happen in living things. Enzymes can work…
Q: Can you please help me fill in the chart on the time a onion root cell will spend in each phase?
A: The duration of each phase of the cell cycle can vary depending on the type of cell and its specific…
Q: Give an example of an environmental condition where stomates are unable to maintain cooling of the…
A: Stomata are small pores found on the leaves and stems of plants that are responsible for gas…
Q: What are some of the similarities and differnces between plant-based and animal-based protein…
A: Iron from animal sources, such as red meat, poultry, and fish, is known as heme iron. Oysters, beef…
Q: Name the layer of the mucosa(tip of arrow).
A: Mucosa or the mucosal membrane is the softest tissue lining the lines of the internal organs and…
Q: describe the transport and kinetics of thyroid hormones in the blood
A: Hormones are chemical messengers produced by glands or cells in the endocrine system that are…
Q: Record the results you obtained for the following tests and organisms: INDOLE PRODUCTION ORGANISM…
A: The nitrogen reduction test is a biochemical test that is used to determine whether an organism has…
Q: A, B, C, and D are all species that live in arctic climates. Note that species B's temperature…
A: This is a question related to ecology and the adaptations of different species to arctic climates.…
Q: summarise the actions of thyroid hormones.
A: Thyroid hormones (triiodothyronine, T3 and thyroxine,T4) play a crucial role in regulating…
Q: Explain the results for each organism. *Nitrate Reduction E. Coli (+) P. aeruginosa (-)
A: Nitrate reduction is a common laboratory test used to determine the ability of microorganisms to…
Q: Work on peer support meeting reflection paper for drug continuum
A: The drug continuum refers to the range of drug use, from non-use to problematic use, and includes…
Q: Reflection for understand the four C’s of addiction?
A: Addiction is a complex and chronic brain disease that is characterized by the compulsive and…
Q: Which is not true of Re-entrant Arrhythmias OA. Occurs when there is a "loop" of self excitation. B.…
A: An electrical impulse in the heart that follows a circular course, or re-entrant circuit as opposed…
Q: Catalase is an enzyme responsible to toxify; H₂O2 toxify; H₂O detoxify; H₂O2 detoxify; H₂O from…
A: Enzymes are biocatalyst that perform specific biochemical reaction inside of the living organisms.…
Q: During what stage Interphase, Prophase, Metaphase, Anaphase, Telophase and Cytokinesis is cell…
A: Cell division is the process by which a single cell divides into two or more daughter cells each…
Q: Mention the symptoms presented by cows with a limp.
A: Limping is an abnormal gait pattern characterized by difficulty or pain when walking, which causes…
Q: How would the evolution of teeth and bones composed of calcite or aragonite, instead of dahllite,…
A: Aragonite and calcite are the two types of calcium carbonate crystals that form the teeth of some…
Q: Which of the following characters evolved last (i.e., most recently)? A) Heredity B) Photosynthesis…
A: All living organisms are organised in some form, whether it is at the cellular level or the organ…
Q: 2. Development of hypersensitivity of the immediate type and its stage
A: Hypersensitivity is caused due to an exaggerated action of the immune system against a foreign agent…
Q: Give two examples (names) for each: C3, C4 and CAM plants. In what environments do you expect to…
A: C3 plants are the most common plants. ~85% of plants are C3 plants. They don’t have adaptations of…
Q: The turtle is likely to synthesize ice nucleating agents. Question options: True False The…
A: Based on data from June to May of 1985, this question concerns the variations in thermal regulation…
Q: the lubber grasshopper is a very large grasshopper,and is black and red and yellow stripes.Assume…
A: Assuming that red stripes are expressed from Gr alleles, yellow stripes from the Gy allele, and no…
Q: What is photoinhibition and how does this concept involve the PSII reaction center protein D1 and…
A: PS II stands for Photosystem II, which is a large protein complex that is involved in the…
Q: 12. Add the following terms to the photo of cardiac muscle at the right: intercalated disc nucleus…
A: Muscular system is a body system which comprises of muscles that are involved in contraction and…
Q: n 2 paragraphs, watch the video on Gym Emergency Procedures and list your 3 takeaways from the video…
A: The video was very informative and I came to know about many new and good things that i was not…
Q: which part of the brain affects the core body temperature when it is raised
A: The hypothalamus is a small but critical part of the brain located at the base of the brain, just…
Q: describe '' one situation in your clinical rotation" something that was valuable experience in…
A: Respiratory therapy includes treating the patients with different respiratory or cardiopulmonary…
Q: Which of the following statements is true regarding the genetic code? O One DNA base contributes to…
A: The genetic code is the set of rules that dictate how DNA information is translated into the…
Q: Normally, a tRNA with the anticodon 3'-GAC-5' would be connected to which amino acid? Asn Leu Asp…
A: The shape of t-RNA is similar to a clover leaf or an inverted L. It has nucleotides in its anticodon…
Q: Summary table of data for one yeast DNA microarray. Shows 14 of the 6,200 genes on the full…
A: A DNA microarray also known as a DNA chip or gene chip is a high throughput technology used to study…
Q: The original wild-type" DNA strand is: -ATGGGACTAGATACC-3'. Which allele is least likely to show a…
A: A DNA mutation is a permanent change in the DNA sequence that can be passed on to subsequent…
Q: Which of the following cloning strategy will be best to clone multiple DNA fragment (~10 fragments)…
A: Gibson assembly is a type of DNA assembly method that allows for the joining of multiple DNA…
Q: No significant rise in blood glucose was observed in sheep injected with saline. This observation…
A: The statement "No significant rise in blood glucose was observed in sheep injected with saline" is…
Q: Some bacteria may produce proteolytic enzymes (molecules that break down proteins) to protect…
A: The question is related to the defense mechanism in human hosts against bacteria and the production…
Q: In a male insulin-like factor 3 'knock out' mouse, predict the phenotype: Select an answer and…
A: Male insulin-like factor 3 (INSL3) is a hormone produced by the Leydig cells of the testes in male…
Q: Draw a whitefish blastula cell in telophase (400x)?
A: The blastula is the stage of embryonic development in which the cells are rapidly dividing by…
Step by step
Solved in 3 steps
- 11 111 FLATRON WIS songs to listen to on a late n (1) Messenger f 253282375 390061782796379 8 x ++ Scontent.fmnl17-4.fna.fbcdn.net/v/t1.15752-9/253282375 390061782796379 8678836692018933574_n.jpg?_nc_cat3D105&ccb%3D1-5&_nc_sid=Dae9488&_nc_eui2=DAeERUdQ E Apps Discussion Questions (answer these questions on a separate sheet of paper) 1. Explain how hCG secretion is regulated. Is it secreted by a pregnant woman or her offspring? 2. hCG depresses some reactions of the immune system. What adaptive advantage do you think this has? Ac P Type here to search LGXist gene is located in a 450 kb region of DNA called the X inactivation center (XIC) and is transcribed only from the future inactive X chromosome. The Xist noncoding RNA (ncRNA) triggers X inactivation by coating the X chromosome that produces it and by recruiting enzymes that mediate Barr body formation. How one X chromosome is chosen to express Xist is unknown. Active X • Histone modifying proteins ~Xist ncRNA XIC O Histone methyltransferase (HMT) Histone acetyl transferase (HAT) Histone deacetylase (HDAC) DNA methyltransferase (DNMT) Inactive X Xist Į Which of these enzymes is unlikely to be recruited by Xist?You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…
- 1 2 3 4 miR-34a Et. Br. miR-34c Et. Br. Figure 1: Northern blotting on total RNA extracted from the testes of mice with the indicated genotypes (Lane1; wild type, Lane 2; miR-34a-/-, Lane 3; miR-34b & c-/-, Lane 4; mutant). Probes specific for miR-34a and miR-34c were used. (i) As compared to Northern blotting which probes for RNA, what are the samples that can be probed by Southern and Western blotting techniques? (ii) Analyze the results in Lane 1 to Lane 4 (Figure 1).a. What is your epigenome (i.e. epigenetics)? b. Does lifestyle affect your epigenome? Explain -c. Does your epigenome change with age? Explain d. What is epigenetic therapy? Is it working? Explain Edit View Insert Format Tools Table 12pt v Paragraph v в I Address DELL F7 F8 F9 F10 F1 F4 F5 F6 # % & 3 4 6. 7 8 9 Y ...e In the figure below, what is represented by the line labeled A? TFIIB recognition element DNA in m 3' G/CGICGIC CGCC -35 TATA box TATAAA -25 A Initiator element YYAN TAYY +1 Downstream core promoter element RGATCGTG +30
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosomedraw the p21 promoter in a cell without E2FFor each of the terms in the left column, choose thebest matching phrase in the right column.a. basal factors 1. organizes enhancer/promoter interactionsb. repressors 2. pattern of expressiondepends on which parenttransmitted the allelec. CpG 3. activates gene transcriptiontemporal- and tissue-specificallyd. imprinting 4. site of DNA methylatione. miRNA 5. identifies DNA-binding sitesof transcription factorsf. coactivators 6. bind to enhancersg. epigenetic effect 7. bind to promotersh. insulator 8. bind to activatorsi. enhancer 9. prevents or reduces geneexpression posttranscriptionallyj. ChIP-Seq 10. heritable change in geneexpression not caused byDNA sequence mutation
- Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below? In addition to phosphorylation, the C-terminal domain of p53 can also be acetylated and sumolated in response to DNA damage. Acetylation and sumolation both result in an increase in the transactivation ability of p53 and may account for this finding. In vivo, IR induces the acetylation of p53 at Lys320 by PCAF and Lys382 by CBP/p300. Acetylation at these sites is dependent on N-terminal phosphorylation at Ser15 and to a lesser extent on phosphorylation at Ser6, Ser9, and Thr18 (Saito et al., 2002; Wahl and Carr, 2001). All of these phosphorylation events are ATM-dependent, although only Ser15 has been shown to be phosphorylated directly by ATM. Sumolation occurs at Lys386 after DNA damage (Muller et al., 2000). Sumolation refers to the covalent attachment of a small ubiquitin-like molecule (SUMO-1) to Lys residues, but in contrast to ubiquitination, does not result…You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5’ promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
