QUESTION 2Which of the following is NOT a correct pairing of the RNA type and its job?O A. rRNA - in combination with proteins forms the ribosome that is the organelle that builds proteinsO B. CRNA - tells the nucleus which protein is needed in the cytosolOC. TRNA - carries amino acids to the ribosome to use in protein buildingO D. MRNA - takes the message of which protein to build from the DNA in the nucleus to the ribosome

Name: QUESTION 2Which of the following is NOT a correct pairing of the RNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: QUESTION 2Which of the following is NOT a correct pairing of the RNA type and its job?O A. rRNA - in combination with proteins forms the ribosome that is the organelle that builds proteinsO B. CRNA - tells the nucleus which protein is needed in the

Introduction:- RNA (ribonucleic acid), complex compound of high molecular weight that functions in…

Science

Biology

Which of the following is NOT a correct pairing of the RNA type and its job O A. TRNA - in combination with proteins forms the ribosome that is the c O B. CRNA - tells the nucleus which protein is needed in the cytosol O C. TRNA - carries amino acids to the ribosome to use in protein buildin

Which of the following is NOT a correct pairing of the RNA type and its job O A. TRNA - in combination with proteins forms the ribosome that is the c O B. CRNA - tells the nucleus which protein is needed in the cytosol O C. TRNA - carries amino acids to the ribosome to use in protein buildin

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter4: Cells

Section: Chapter Questions

Problem 2TYK: Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only...

See similar textbooks

Similar questions

ture.com/courses/132776/quizzes/489888/take O Ribosome Question 22 22. During transcription, what does messenger RNA do? O It strings together two complementary RNA strands O It strings together two complementary DNA strands O It constructS proteins out of random amino acids O It delivers DNA's Instructions for making proteins Question 23
A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2.Scientist wanted to determine what molecule held the ‘gene ‘ if they did a study in which a cell was infected by a virus,which part of the virus actually caused the infection inside the cell!? -Dna -ribosome -protien -Rna
Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking protein translation Because specific gene silencing leads to blocking mRNA transcription Because specific gene silencing leads to blocking DNA replication All answers are correct
Which of the following is NOT a ribonucleoprotein (protein-RNA complex)? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b C d e mRNA exiting through a nuclear pore RNA polymerase II the ribosome telomerase signal recognition particle
A point mutation within the DNA sequence of a gene, which turns the codon UGU (codes for the amino acid cysteine) into the codon UGA would Question 47 options: build in another amino acid into the growing polypeptide chain at the ribosome build in the same amino acid (= cysteine) at the ribosome most likely lead to a stop of protein translation at the ribosome build in two amino acids into the growing polypeptide chain instead of one prevent the release of the amino acid from the tRNA in the P-site of the ribosome
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only eukaryotes contain a large subunit. b. both contain the same number of proteins. c. both use mRNA to assemble amino acids into proteins. d. both contain the same number of types of rRNA. e. both produce proteins that can pass through pores into the nucleus.
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Question 1: The c-myc gene has several exons. What are the stages of the maturation process that its main transcript must undergo before becoming a mature mRNA Question 2: In which cell compartment does mRNA maturation take place?
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
If a DNA strand with the sequence GGCATGCCTATGCGA is transcribed, which of the following accurately represents the newly synthesized mRNA strand? Question 10 options: GGCATGCCTATGCGA CCGTACGGATACGCT CCGUACGGAUACGCU