Q: So far we have discussed changing environments affecting your species at risk. Changing environments…
A: Introduction Environmental effect:- It is the result of environmental impacts on human health and…
Q: Using a T chart illustrate the differences between type I diabetes and type II diabetes.
A: Introduction Diabetes is a group of disorders that impact your body's ability to use blood sugar…
Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…
A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…
Q: In a couple paragraphs, describe the connection and correlation between the red-shouldered hawk, the…
A: Introduction A statistical approach for determining the relationship between quantitative and…
Q: All of the following may be important keystone species due to their roles as pollinators EXCEPT:…
A: Keystone species are any species whose removal or reduction from an ecosystem adversely affects the…
Q: Why do cancer cells undergo EMT and MET? What are the cellular changes (expression or suppression of…
A: Answer
Q: Learning Task 13-1: Diseases Caused by Mutations Disease What gene is affected by Mutation? What is…
A: A genetic disorder is a medical condition caused by one or more genetic defects. A chromosomal…
Q: Which of the following is not true of the protists? (a) they are unicellular, colonial, coenocytic,…
A: Any unicellular or multicellular creature which is not a mammal, plant, or fungus is referred to as…
Q: EMERGENCY OF TEETH EMULSION, DELAY OF WEATHERING AND DEFECTS OF MINERALIZATION ARE CONSIDERED BY…
A: Introduction :- The conversion of biomass to gaseous form, water, salts, and minerals, as well as…
Q: How do proteases liberate bioactive peptides from various protein sources? Give different examples…
A: Proteases, also known as proteinases or proteolytic enzymes, are a large group of enzymes that…
Q: 3) Describe "hub" molecule pyruvate that serves different pathways. Explain metabolic regulation…
A: Introduction: In mammals, metabolic regulation refers to the process through which metabolic…
Q: What are the most important environmental challenges that plants face living on land?
A: An environment can be defined in biology as a collection of chemical, physical, biotic, and other…
Q: In sweet peas the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,…
A: Synthesis of purple anthocyanin pigment in sweet peas.
Q: Birds generally have life-histories that can be placed on a fast-slow continuum. Species with fast…
A: Life history theory explains the general features of life cycle, i.e., how fast the organism grows,…
Q: fluid regulation process in animals.
A:
Q: Red blood cells shrivel when placed in a 10% sucrose solution. When first placed in the solution,…
A: Introduction :- Red blood cells' primary function is to transport oxygen from the lungs to the…
Q: What is meant by the description "antiparellel" regarding the two strands that make up DNA?
A: DNA is a double stranded molecule which is composed of two long polynucleotide chains. A nucleotide…
Q: To find: The artery that carries oxygen-poor blood.
A: The blood vessels carry blood in the human body. There are three types of blood vessels - 1.…
Q: Which of the following statement(s) about the digestive system is (are) correct? SELECT ALL THAT…
A: The alimentary canal and the gastrointestinal accessory organs make up the human digestive system.…
Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…
A: Mutation is a permanent variation of some nucleotide sequences in an organism's genome that can…
Q: To determine: The reason for the occurrence of rigor mortis and why it ends only when the myosin…
A: Introduction Rigor mortis:- It is a postmortem change resulting in the stiffening of the body…
Q: 1. Which of the following is true? A. Carnivores eat both animals and plants B. Omnivores eat both…
A: Note: As per the guidelines, since all these questions are not interlinked the first three have been…
Q: How would the slowest band from the HinDIII-digest of pGLO align with the the bands of the ladder?…
A: Plasmid It is usually circular extra chromosomal piece of DNA present in bacterias and some…
Q: 10 Equipment use in Expanded Programme on Immunisation
A: Introduction Immunization:- It is the process of giving a vaccine to a person to protect them…
Q: Draw a simple diagram illustrating alternation of generations in plants, including the sporophyte…
A: The alternation of a sexual phase (n) and an asexual phase (2n) in the life cycle of an organism.…
Q: 1. What hookworm penetrate into the skin and causes potbelly of malnutrition, microcytic and…
A: INTRODUCTION Parasites These are organisms that lives in a host and take food from the host…
Q: Blood sugar regulation is an example of negative feedback. Explain the science behind this…
A: Answer
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: b) In eukaryotes, the newly synthesized mRNA undergoes modifications before it is transported across…
A: In eukaryotic cells, transcription is a process in which genetic information in the DNA is converted…
Q: Which of the following is not a recoding event? O a. Bypassing O b. Reverse mutation Oc. Novel amino…
A: Deamination of adenosine bases in RNA results in transcripts that contain one or many inosine bases,…
Q: differentiate a nodule from a root gall? (
A:
Q: What physical activity that can change the blood pressure nd how to restore and maintain to normal?
A: Physical activity that can change the blood pressure.
Q: To explain: Why the cancer treatments cause hair to fall out.
A: Cancer is a well known that they're supposed to define that they are condition in which cells grow…
Q: 2. Consider the populations (1000 individuals) with the following genotypic frequencies: Population…
A: Hardy Weinberg law or Hardy Weinberg Equilibrium is an explanation for how variation is maintained…
Q: Question attached
A: The photons are referred to as the elementary particles that have the role of serving as a quantum…
Q: 27. A CD8 cell will bind with a A MHC I receptor B. MHCII receptor
A: Answer
Q: To determine: The reason for the occurrence of rigor mortis and why it ends only when the myosin…
A: Rigor mortis is primarily caused by chemical changes in the muscles after death, which cause…
Q: by upar dn
A: DNA is a double stranded molecule. Both the strands of DNA are linked together by hydrogen bonds.
Q: 2 AXIS (left side) '3
A: In frog the axial skeleton has a skull, vertebral column, sternum and ribs.
Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…
A: Mutation is a permanent change in some nucleotide sequences in an organism's DNA that can cause…
Q: BACTERICIDAL LAMPS, MUST BE INSTALLED IN ASSISTENTSKAYA, BECAUSE 1. the work in the assistant room…
A: An electric light that generates ultraviolet C light is known as a germicidal lamp. Short-wave…
Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…
A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…
Q: -In the kennedy class IV, II,I take the support from abutment and most prominent bone should have…
A: There are few important points that should kept in mind . Which are as follows: Applegate's rules…
Q: Which is NOT true of eukaryotic cells? A) A true nucleus contains the DNA in the form of…
A:
Q: Trace the paths that water and mineral ions travel as they movefrom soil into a root’s vascular…
A: The underground branching root systems of plants are frequently larger than the aerial component of…
Q: a. Suppose there are two genes - A and B - that specify production of the same enzyme. These two…
A: In an autosomal recessive disorder, one mutated gene is inherited from each parent. The parents each…
Q: (A) G = rN K – N) K G=N (C) (B) (х-аxis) Question: Which of the following labels for x- and y- axes…
A: This is the graph of exponential and logistic growth of population. The 2 categories of population…
Q: B.cereus
A: Bacillus is a genus of rod shaped, gram positive aerobic or facultatively anaerobic bacteria found…
Q: To explain: The reason for careful attention being given to the diet of infants; especially…
A: The brain is the part of the body in charge of controlling its overall functions. It governs all of…
Q: Suppose that the circulating concentration of hor-mone is 10–10 M and the Kd for binding to its…
A: To function properly, the body generally knows that they are supposed to require coordination…
I need help with
What is the magnification of each of the following objectives?
scanning:
low power:
high dry:
oil immersion:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- MICROBIOLOGY: Microscopic Morphology of Microbes Write your introduction (This includes principles, significance of the study, objectives of the experiment and how the objectives were achieved. This part must also be in the passive voice and past tense. Introduction must be short but packed with relevant content). another: What is the advantage of the Gram stain over the simple stain? What is the theory about the mechanism of the Gram-stain reaction?困 Topic: laboratory Instrument Which of the following are TRUE regarding Which of the following is/are TRUE the use of laboratory instruments and regarding the use laboratory instruments equipment in regards to making of culture media? " and equipment? * Air bubbles on the surface of agar plates Hot plates can be used to sterilize the inoculating loop and needle. can be removed by fanning them with the luminous flame of the bunsen burner. If the agar surface is wet, it can be dried by A drying oven is used to sterilize nutrient agar, a solid culture medium. heating at 30-40 deg C in the drying oven before inoculation is done. The refrigerator is used to grow psychrophiles. All media taken from the refrigerator should be warmed to room temperature before use, P Type here to search 7:11 pm 30/09/2021 ヘロG) ENG 近Give the uses/functions and images of each apparatuses. Basic Laboratory Equipment Uses/Functions Picture 1. Microscope 2. Colony Counter 3. Autoclave 4. Microbiology incubator 5. Drying oven 6. Refrigerator (microbiology) 7. Bunsen burner/alcohol lamp 8. Candle jar 9. Anaerobic jar 10. Microhood or Bacteriologic hood/Safety hood/Safety cabinet 11. Bacteriologic filters (Seitz, Chamberlain, Berkfield) 12. Petri dish 13. Culture tubes 14. Hanging drop slide 15. Durham’s tube 16. Staining rack 17. Thermostatically controlled water bath 18. Inoculating loop 19. Inoculating needle 20. Vials
- INSTRUCTIONS: Please do not copy here in Bartleby or in Google. QUESTIONS : 1. Why is it importance to heat the lid of the petri pate where you will grow the microorganism? Explain.G When is it appropriate for gloves X + rface/defaultui/player/modern.html?configuration=&preventRightClick=False&cc=en-US&ieCompatibilityMod... 2 Exit rientation to Infection Prevention Which of the following are proper disinfection steps? Check all the apply. O Remove organic matter O Disinfect only O Follow suggested contact time O Mix cleaning products to make the disinfectant more powerful O Disinfect O Disregard the product labels SUBMIT ENG INWhat will pose an ethical issue in these procedures are performed - mutilation, sterilization?
- Subject : Environmental Microbiology Can u use the information given below to answer these 2 question 1.Provide an aim for this lab 2. Provide objectives DISCUSSION QUESTIONS What is the relationship between the resolution power and the useful magnification that may be obtained with the light microscope? What determines the resolving power of the lens system? What is the limit of resolution obtainable with the light microscope? How you will distinguish between bright field and dark-field microscopy and provide a specific example where each would be method of choice for observing a culture of bacteria? What advantages does electron microscopy have over light microscopy? What are disadvantages of electron microscopy over light microscopy? #Compare the use and the methodology of TEM with SEM? Provide at least one example where each would be the method of choicwhat do the colors in the kirby bauer plate represent black/dark area = tan/yellow are small white circles Match choices - - source of the chemical being tested for antimicrobial activity - locations where the bacteria was able to grow - bacterial innoclunum being tested for sensitivity - locations where the bacteria was not able to growTell me three things about how cultures are handled in a clinical laboratory.
- izzes/00071/take/questions/600381 Regarding Gram staining, what will be the appearance of the Gram-positive bacteria if... All steps are done correctly? The slide is not heat-fixed prior to staining? Crystal violet was omitted? lodine was omitted? Only iodine was used? Acetone:alcohol was omitted? Too much acetone:alcohol was used or was left on for too long? I Not enough acetone:alcohol was used? Carbol fuschin or safranin was omitted? W [Choose ] [Choose ] Purple Clear Pink Orange [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] 88 22°CGive the uses/functions and images of each apparatuses. Basic Laboratory Equipment Uses/Functions Picture 1. Microscope 2. Colony Counter 3. Autoclave 4. Microbiology incubator 5. Drying ovenGeneral Instructions:Choose 1 bacteria/diseases and fill out the details. An example of an answered template is also provided for your reference. Causative Agent and Disease Profile for S. aureus Template and Example ITEM MSM PROFILE MICROBIAL PROFILE I MICROORGANISM/CAUSATIVE AGENT Staphylococcus aureus A GRAM REACTION (+) B OXYGEN REQUIREMENT Facultative Aerobes C SIZE 1.5 µm D SHAPE Cocci in clusters E HABITAT Normal flora of skin/anterior nares/pharynx F DISCOVERY G MICROSCOPIC IMAGE II DISEASE PROFILE Scalded skin syndrome A DISEASE/S Skin and Wound Infections Scalded Skin Syndrome Toxic Shock Syndrome Food Poisoning Pneumonia B SYMPTOMS OF THE DISEASE A high fever · Nausea and vomiting · A rash on your palms and soles that resembles a sunburn C INCUBATION PERIOD 2 and 4 hours (range 30 minutes to 8 hours) D MODE OF…