The data below depicts the binding of the E coli RNA Polymerase to DNA containing a promoter sequence or random DNA. The data also illustrates the binding of the RNA Polymerase ins the presence of Protein X. What is the likely identity of Protein X? Justify your answer (limit 4-5 sentences). Random DNA % Bound to DNA 120 100 80 40 20 0 0 DNA with Promoter 20 40 RNA Pol RNA Pol + Gene X 60 [RNA Pol] nM 80 100 120 % Bound to DNA 120 100 80 60 40 20 0 -RNA Pol --RNA Pol + Gene X 20 40 60 [RNA Pol] nM 80 100 120

The data below depicts the binding of the E coli RNA Polymerase to DNA containing a promoter sequence or random DNA. The data also illustrates the binding of the RNA Polymerase ins the presence of Protein X. What is the likely identity of Protein X? Justify your answer (limit 4-5 sentences). Random DNA % Bound to DNA 120 100 80 40 20 0 0 DNA with Promoter 20 40 RNA Pol RNA Pol + Gene X 60 [RNA Pol] nM 80 100 120 % Bound to DNA 120 100 80 60 40 20 0 -RNA Pol --RNA Pol + Gene X 20 40 60 [RNA Pol] nM 80 100 120

Name: The data below depicts the binding of the E coli RNA Polymerase to DN
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The data below depicts the binding of the E coli RNA Polymerase to DNA containing a promoter sequenceor random DNA. The data also illustrates the binding of the RNA Polymerase ins the presence of Protein X.What is the likely identity of Protein X? J

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 = Start codon Positions 4800-4802 = Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?
1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >
Transforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.
Different sensitivities to the mushroom toxin a-amanitin distinguish the three RNA polymerases from one another. Which of the following properties listed below also distinguish RNA Polymerase II from Pol I and Pol III? Options: Only RNA Pol II possesses a large subunit RNA Polymerase I and RNA Polymerase III do not require TBP for optimal transcription efficiency only RNA Polymerase II requires an ATP-dependent helicase to melt the DNA around the transcription start site Only RNA Polymerase II resembles the prokaryotic RNA Polymerase RNA Pol II has an extended N terminal region that becomes phosphorylated during intiation
Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................
Editing during DNA replication is provided by DNA polymerase enzymatic activity of O 5'-> 3' polymerase 3'-> 5' polymerase O 3'-> 5' exonuclease O an extra enzyme that binds to DNA polymerase O 5'-> 3'exonuclease
The sigma subunit of bacterial RNA polymerase ________________________. is required for the initiation of transcription binds to the RNA polymerase core enzyme must be released from the RNA polymerase for transcription to enter the elongation phase binds to the bacterial promoter sequence All of the other answers are correct.