The complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5' CAUAUUGGGAGGAAU 3' O 5' UAAGGAGGGUUAUAC3' 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'
Q: 7) The mammalian kidney is filled with over 1 million nephrons and this organ is considered a highly…
A: Kidneys are the complex excretory system consisting of nephron which is considered as the basic…
Q: What is Phylogeny for reptile, including the names of each lineage but also all the clades…
A: Introduction Phylogenetic relationships refer to the evolutionary relationships between organisms.…
Q: In order to examine the relationship between experiences of bullying (exposure) and depression…
A: Analytic studies in epidemiology are studies which conduct to examine and assess the conditions…
Q: Biology Question
A: Cancer is defined as the uncontrolled division and proliferation of cells due to mutations that…
Q: Your friend Chad is carrying some firewood in his outstretched arms. While his eyes are closed…
A: Introduction The Golgi tendon is a proprioceptive sensory receptor located in the tendons of…
Q: flowers bed indb #.N.P.K pieda outer layer germinal ground tissue: ● ● Aggregates of cells -…
A: Tissues are aggregates of cells. These cluster of cells work together to perform a specific…
Q: the graph is depicting the size of eggs and number of eggs for the mycalesis terminus butterfly. the…
A: The host plants on which the Mycalesis terminus butterfly lays its eggs have a considerable impact…
Q: Discuss the differences, advantages and disadvantages of the above mentioned vaccines with the…
A: Introduction COVID-19 vaccination helps protect you by creating an antibody response without you…
Q: In a cohort study, the ratio of the incidence rate of a disease in an exposed group to the incidence…
A: Cohort study It is a kind of observational or non-experimental study design. In this study, the…
Q: Which of the following is an "ecological" variable, that is, an exposure or an outcome that needs to…
A: Ecological study designs are a type of epidemiological study design that focus on the relationship…
Q: Explain in simple terms and defin
A: ANSWER) Primary plant growth occurs through the rapid cell division occuring in the apical meristems…
Q: 1. Ionotropic GABA receptors are ligand-gated Cl channels which open during GABA-ergic signaling. a)…
A: Introduction Neurons are specialized cells that are the basic building blocks of the nervous system.…
Q: 1. The granularity of each cell is measured by side scatter. Many of the cells flowing through the…
A: Introduction Blood cells are the cells that circulate within the blood and are responsible for…
Q: Explain why adipose cells exhibit the characteristic signet ring appearance
A: Introduction Adipose cells, also known as fat cells, are specialized cells in body that store energy…
Q: RNA differs from DNA in that: All are correct ORNA contains ribose. RNA contains uracil ORNA is…
A: RNA stands for Ribonucleic acid. It is a type of nucleic acid that is found in all living cells. RNA…
Q: You are working as a Research Scientist I at Albany Molecular Research. For one of your bacterial…
A: To determine the mass of a substance, we must first determine its molecular weight and molarity.…
Q: 41. Which of the following would be an effective way to improve iron status? Consume plant…
A: Introduction :- There are numerous vital bodily processes for which iron is a necessary mineral. It…
Q: According to Claire Sterk, what assumptions did she enter her study with? What were the common…
A: "Fieldwork on Prostitution in the Era of AIDS" is a book written by Claire E. Sterk. The book was…
Q: In the absence of a perichondrium, how does fibrocartilage get its nourishment
A: Cartilage is a strong substance which present in our bone joint. It is tough, flexible tissue which…
Q: Ways to reduce the risk of hypertension
A: Abnormally high blood pressure and a combination of high psychological stress are known as…
Q: drug
A: Drug: It is the chemical substances whichaffects or alters the physiological functions when taken…
Q: Consider three alpha-motor neurons of different sizes: small, medium and large. All three neurons…
A: Introduction Neurons are the basic building blocks of the nervous system, which is responsible for…
Q: How do we get the expected?
A: The genotype is the set of genes in DNA responsible for a trait. In a way it refers to combination…
Q: The global system of protected lands and water is designed to overlap with ecosystems that contain…
A: Introduction An ecosystem is a group of living things that interact with one another and with their…
Q: 1. Using the data available describe the phenotype that you observe when each of these three genes…
A: The question is related to the use of RNA interference (RNAi) to study the function of specific…
Q: How have opiate analgesics been reformulated to reduce their abuse potential?
A: Introduction :- Opiate analgesics are a class of medications that are used to treat pain. They work…
Q: add on and summarize All education starts at home. A school is bound within limits when it comes to…
A: Note:- Sorry, as per the honor code we can not share personal opinions, however, we will provide…
Q: 3. The cell growth in problem 1 is now transitioned to a 12.0 L continuously-stirred tank reactor (a…
A: Cells grow during a continuous bioreactor under continual feed supply and waste removal conditions.…
Q: why is estradiol most potent natural estrogens? and if it exclusively derived from the ovries?
A: Estradiol is a naturally occurring hormone and the most potent form of estrogen in the human body.…
Q: Which one of the following statements about RNA and DNA is false? ODNA is generally more stable than…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are two types of nucleic acids that are…
Q: How does the nuclear envelope differ from the plasma membrane? How do molecules move between the…
A: The mebrane-bound, dense, round, cellular component that houses the genetic material (DNA) which…
Q: HIV destroys cells by causing dendritic cells to fuse with CD4 cells and cause ______ formation.
A: HIV (Human Immunodeficiency Virus) is a retrovirus that primarily attacks CD4 T-lymphocytes, which…
Q: 2. Label the muscles on the dorsal and ventral sides of answers in the next page after each diagram.…
A: Frog muscles are composed of various muscles located in different parts of their body. These muscles…
Q: Avidin exists as a protein complex of around 68 kDa. Research to determine the types of interactions…
A: The avidin protein complex is an attractive subject to investigate because of the unusual…
Q: Irreversible organ failure remains a worldwide concern as demand for transplantable organs far…
A: Neomycin: Neomycin is an antibiotic medication used to treat or prevent bacterial infections. It…
Q: How are pesticide resistant crops created and what are the advantages of the same?
A: Introduction :-Pesticide resistant crops are created through genetic engineering techniques that…
Q: Which of the following cell line types are typically utilized for the broadest spectrum of virus…
A: Introduction :- The cell line type typically utilized for the broadest spectrum of virus isolation…
Q: Considering the tree above, which of the following is the most distantly related to wheat?
A: A set of creatures' evolutionary ties are hypothesized through phylogenetic trees. The morphological…
Q: A group of bulls (group 1) which contains 25 bulls is to graze a 5ha paddock with a pre-grazing mass…
A: According to the given question, we have to find the number of days that the group of bulls in…
Q: Multifunctional protein kinases O phosphorylate various targets with the correct consensus sequence…
A: Multifunctional protein kinases catalyse the transfer of a phosphate group from ATP to a specific…
Q: Addition of which of the following would increase the rate of actin depolymerization on the minus…
A: Introduction: A vital component of many cellular processes, such as cell motility, cytokinesis, cell…
Q: Which of the following is the most appropriate measure of association used in case-control studies?…
A: Introduction A case-control study is a type of observational study design used to investigate the…
Q: Describe the opioid receptors. What are the endogenous ligands for those receptors? What happens…
A: Introduction : Opioids function by inhibiting the brain from sending pain signals. They bind to…
Q: 3. Haplopappus is an annual flowering plant that grows in deserts. It is of interest because its 2n…
A: Introduction The cell cycle is the sequence of events that occur in a cell leading to its division…
Q: Give correct typing answer with explanation and conclusion A student in Biol 207 needs to make 150…
A: In molecular biology, agarose gel is commonly used for electrophoresis to separate DNA fragments or…
Q: 2. Using Chapter 40 (especially Fig 40.4) of our textbook, compare the circulatory systems of the…
A: Frogs are amphibians, which means they can live on land as well as in water, whereas perch are fish…
Q: High concentration of ATP in the cell causes activation of glycolysis by phosphofructokinase 1. True…
A: Phosphofructokinase 1 is an enzyme involved in the priming stage of glycolysis. It mediates the…
Q: Give typing answer with explanation and conclusion What challenge does the presence of normal…
A: Introduction Microbiota refers to the collection of microorganisms that live in a particular…
Q: WHAT ONE ADAPTATION OF A MICROBE HAVE THAT ENABLES THEM TO SURVIVE LOW TEMP., HIGH PRESSURE. HIGH…
A: Introduction :-There are many different adaptations that microbes can have to survive extreme…
Q: Mycorrhiza – What is mycorrhiza? Describe the differences between the two main categories…
A: Introduction Fungi are a diverse group of organisms that are found in almost every ecosystem on…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which forward are reverse primers will amplify the following sequence by PCR? 5' GACCTCGCCGACGCCCTCGACCAGCTCCTGCGCCGCACCCGCCACCTCGCCGAGACC GAGCAGAAAACCCGCCGTCGGAGAGCCACCCGCTCCGGTACGGCAGCACAGTTGCCCGA TCTTCCAGGCCAGCGGCGCCCATTCGACGCAGAGACCGCACCGGCCCCGGCACCGGACT GGAGCGAGAGCCTGGACGACCTCATCAGCGTCGACACGGCGGCCCAGACCGGCACGAGC GAGATGGAGGGCGCGAGCGTGCCGCCGGCCGAGGCAGGCGGGTACGGGCTGTGGGACGC CGAAGCGGAAGCCGAGCAATGGTGAACGCCTCACCGGGCACGAGCGATACGCCGGG 3'This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
- 5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe Universal Genetic Code Table can be used to determine the gene product of a given nucleotide sequence. Universal Genetic Code Table Second Letter A G UUU } Phe UCU UAU } Tyr UGU } Cys UUC UCC UAC UGC Ser UUA } Leu UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG Trp CUU CAU CCU CCC CGU } His CUC CAC CGC Leu Pro Arg CUA ССА CAA CGA } Gin CUG CCG CAG CGG AGU } Ser AUU ACU AAU } Asn AAC AGC AUC A AUA Ile ACC Thr ACA AAA AGA } Lys } Arg AUG Met ACG АAG AGG GUU GCU GAU GGU } Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA } Glu GAG GUG GCG GGG The table below represents the transcription of a short peptide sequence in a human cell. Place the amino acid abbreviations that correspond to the nucleotide sequence when it is translated. DNA TTG CTG TGT GAG GCA MRNA AAC GAC ACA CUC CGU Protein (реptide sequence) :: Ala :: Arg : Asp :: Asn :: Сys : Gln : Glu : Gly :: His : lle : Leu : Lys : Met : Phe :: Pro :: Ser :: Thr : Trp : Val Third Letter First Letter
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY