Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of the following amino acid sequences could result from a frameshift mutation (+1 or -1) in the part of the gene that encodes this sequence of amino acids? O O N... Gly- Ala-Asn - Ser - Leu ...C N...Ala-Ala-Arg-Pro - Lys...C N...Gly-Gly-Thr-Thr-Glu...C N... Gly-Ala-His-lle - Val ...C N... Gly-His-Thr - Met - Val ...C
Q: You are hired in one of the microbiology labs in Memphis and your first assignment to identify…
A: Gram staining is a common microbiological technique that divides bacterial species into two…
Q: Which statement about the relationship between genetic map and physical map is FALSE? The…
A: Genetic Map: A genetic map, also referred to as a linkage map, illustrates the relative positions of…
Q: How would this protein be arranged in the ER membrane? Red is signal sequence/start. Yellow is stop…
A: N - TERM ER ExplanationRed start sequenceBlue - protein sequenceYellow - stop transfer sequence So…
Q: A researcher is examining the distribution of an ion channel protein in the kidney. She incubates…
A: The objective of the question is to identify the part of the kidney where the ion channel protein is…
Q: Anaerobic Metabolism (Glycolysis AND fermentation) diagram drawing with arrows for CBC250 cell…
A: Production of ATP in the absence of oxygen is called anaerobic metabolism.It takes place when there…
Q: The size of a virus is approximately 10 raised to the power of (a) ________ meters
A:
Q: Viruses encode many ways to antagonize the Pkr pathway. Which is not a direct target of viral Pkr…
A: The question is asking us to identify which among the given options is not a direct target of viral…
Q: Strato of Lampsacus, a student of Theophrastus in Aristotle’s Lyceum, made which of the following…
A: The question is asking about the contradiction made by Strato of Lampsacus, a student of…
Q: If activation of RAAS is the independent variable and arteriolar resistance is the dependent…
A: The Renin-Angiotensin-Aldosterone System (RAAS) is a hormone system within the body that is…
Q: A 22-year-old man is brought to the emergency department in respiratory distress 15 minutes after he…
A: The case study details a 22-year-old man who was stung by a wasp and developed an allergic reaction…
Q: Choose all that apply. We sample a population and genotype 2 loci on 100 chromosomes. We find the…
A: A chromosome is a thread-like structure made of linked proteins and DNA that is located in the…
Q: With regard to local blood flow regulation, which of these substances will produce vasoconstriction?
A: The objective of the question is to identify the substances that can cause vasoconstriction, which…
Q: C. Illustrate the cell at meiotic metaphase I D. Illustrate the cell at meiotic anaphase II
A: Meiosis is a reductional devision of cell i.e. the number of chromosomes decrease at the end of this…
Q: Explain(in terms of biological or chemical impacts on aquatic ecosystems) why plant nutrients…
A: The objective of the question is to understand why plant nutrients are considered the worst kinds of…
Q: Based on the same attached figure as above (Figure 10.9 in your textbook), what kind of channel…
A: Mechanoelectrical Transduction K+ channelsExplanation:The type of channel that permits K+ (potassium…
Q: In which of the following organs are fenestrated endothelial cells common? A. Heart B. Liver C.…
A: The question is asking us to identify the organ where fenestrated endothelial cells are commonly…
Q: We are confronted with a new RNA virus that uses x-proteins to attach to host cells and primarily…
A: RNA-dependent RNA polymerase (RdRp) inhibitors are a class of antiviral drugs that target the…
Q: Microscopic examination of a section of a normal young adult ovary reveals large numbers of…
A: The question is asking us to identify the phase of the cell cycle in which the large cells found in…
Q: Which of the following forces of evolution tends to slow down population divergence and prevent…
A: In the context of genomics, evolution is the process by which living things undergo alterations in…
Q: The modified structures at the border of the epithelium shown above are immotile in a 23-year-old…
A: The question is asking about the consequences of immotile structures at the border of the epithelium…
Q: describe the path of Oxygen through the body. describe the path of CO2 in the body.
A: Organisms utilize oxygen (O2) to indirectly break down nutrient molecules and produce energy for…
Q: In Aristotle’s scala naturae, the zoophytes (like sponges and sea anemones) possess: nutritive…
A: The objective of the question is to understand the classification of zoophytes (like sponges and sea…
Q: Prepare a report on calcitriol hormones
A: Introduction:Calcitriol is the hormonally active form of vitamin D, also known as…
Q: You are investigating a case in which an accountant is accused of keeping fraudulent books for a…
A: -Temporary Files and Cache: Check for temporary files and cache data generated by both accounting…
Q: A 27-year-old male presents to the doctor with complaints of "heartburn" and painful, sour-tasting…
A: The question is asking about the type of mucosa that is normally found in the distal esophagus. The…
Q: As mentioned in class, one additional major use of ATP in skeletal muscle (besides powering the…
A: Assumptions:The volume of a single sarcomere is roughly cylindrical.The average diameter of a…
Q: 26. On the photo below circle and label the cell of origin for each of the four subtypes of leukemia…
A: Leukaemia is the cancer of white blood cells. In leukemia there is an uncontrolled division of…
Q: they are called: If polyploid species have complete sets of chromosomes from two or more different…
A: Polyploidy is a condition in which an organism has more than two sets of chromosomes. There are…
Q: A gypsy moth population has overtaken a grove of oak trees. The gypsy moths eat the trees, causing…
A: The objective of the question is to identify the type of density-dependent factor that the gypsy…
Q: Theophrastus of Lesbos, Aristotle’s successor as head of the Lyceum, improved upon Aristotle’s…
A: The question is asking for the correct classification of dicotyledons, a group of flowering plants,…
Q: Damage to which of the following structures might produce hair cell loss? A.Basilar membrane B.…
A: The question is asking about the structure in the human ear that, if damaged, could result in the…
Q: Using the diagram above, answer questions 26-35: 26) To focus on a specimen when you are using the…
A: 26) To focus on a specimen when you are using the scanning power objective lens, you would use the…
Q: Nissl bodies correspond to which of the following cytoplasmic organelles? A. Golgi apparatus B.…
A: The question is asking to identify the cytoplasmic organelle that corresponds to Nissl bodies.
Q: Exponential population growth occurs when N=K. True False
A: The statement in question is referring to the concept of population growth in biology, specifically…
Q: In Aristotle’s scala naturae, which of the following animal groups possess all four types of “souls”…
A: The question is asking us to identify which group of animals, according to Aristotle's scala…
Q: Which of the following fitness relationships among three genotypes at a single locus represents the…
A: Overdominance, also known as heterozygote advantage, is a phenomenon in genetics where the…
Q: Is current number of species always the same or very close to average number of species? If not,…
A: No, the current number of species on an island is not always the same or very close to the average…
Q: Chestnut blight is a type of fungus that affects the American chestnut tree. The fungus wiped out a…
A: The objective of the question is to identify the type of density-dependent factor that the chestnut…
Q: A 45-year-old man without a history of bleeding or excessive bruising dies suddenly due to rupture…
A: The objective of the question is to understand the role of fibrillin in the human body and what…
Q: What do scurvy, brittle bone disease, and the hyperextensibility syndrome have in common?
A: Scurvy, brittle bone malady (osteogenesis imperfecta), and hyperextensibility syndrome (regularly…
Q: Select the statements below that are TRUE. Select 4 correct answer(s) Question 14 options: A)…
A: This question tests your understanding of various genetic phenomena:Mutations: Spontaneous changes…
Q: Describe the steps by which the transport of electrons down the respiratory chain leads to the…
A: Oxidation of NADH The NADH and FADH2 produced in the glycolysis, and citric acid cycles are first…
Q: Which of the following is NOT true about cis-regulatory elements (CREs)? Group of answer choices…
A: Non-coding DNA sections called cis-regulatory elements (CREs) control the interpretation of…
Q: A scientist is studying a wild population of Japanese morning glories. It is easy to separate…
A: Given: A scientist is studying a wild population of Japanese morning glories. The population…
Q: What drug produces myosis, which will contract the pupil of the eye?
A: Myosis refers to the extensive constriction of the pupil of the eye. It is the part of the eye that…
Q: A study on reproductive success showed a positive relationship between hatching failure and F, the…
A: The research focuses on a chickadee population situated in northern Maine, investigating the…
Q: The diagram below represents the ranges of 3 species (A, B, and C), which are separated by a…
A: The mechanism by which populations diverge to become new species is known as speciation. The word…
Q: Researchers want to determine if a single locus has a large effect on the color of the throat…
A: In genetics, a locus (plural loci) is a specific, fixed position on a chromosome where a specific…
Q: 3. Increased vascular permeability leads to which of the following cardinal signs of inflammation?…
A: B) EdemaExplanation:The increased vascular permeability that occurs as a result of the inflammatory…
Q: A surgical pathology specimen from a 24-year-old woman seen at a reproductive medicine clinic…
A: The question is asking to identify the location in the female genital tract from which a biopsy was…
Trending now
This is a popular solution!
Step by step
Solved in 1 steps
- A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?Shown below is a portion of primary sequence of a very large protein. -Gly-Pro-Arg-Gly-Pro-Hyp-Gly-Ser-Ala-Gly-Ser-Hyp-Gly-Lys-Asp--- Which of the following structures is most likely formed from this protein sequence? D A. A О В. В OC.C O D. D OE. E B.In relation to the peptide sequence that is presented. -Gly - Ser – Cys – Asp – Glu – Arg – Cys – Arg- ................ S_____________________S The correct option is A. Contains more negative than positive residues B. Contains only one charged alpha-aa C. The formation of the disulfide bridge is incorrect D. Hydrophilic and charged residues predominate
- The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…
- Sickle-cell disease is caused by a so-called point mutation in the humanβ - globin gene. A point mutation is the result of a single base substitution inthe DNA encoding a gene. The sickle-cell mutation results in the substitutionof Val for Glu at position 6 in the β - globin protein.(a) Using the information in as shown, explain how a point mutationcould change a codon for Glu to a codon for Val.(b) Do you expect the pI for the sickle-cell β - globin to be higher or lowerthan the pI for wild-type β-globin ? Explain.Which amino acid sequence will be generated during translation from the following small mRNA: …CCC-AUG-UCU- UCG-UUA-UGA-UUG…? (Hint: Remember where translation starts and stops.) (a) Met-Glu-Arg-Arg-Glu-Leu (b) Met-Ser-Ser-Leu-Leu (c) Pro-Met-Ser-Ser-Leu-Leu (d) Pro-Met-Ser-Ser-Leu (e) Met-Ser-Ser-LeuSickle-cell disease is caused by a so-called point mutation in the humanβ-globin gene. A point mutation is the result of a single base substitution inthe DNA encoding a gene. The sickle-cell mutation results in the substitution of Val for Glu at position 6 in the β-globin protein.(a) Using the information in Figure, explain how a point mutationcould change a codon for Glu to a codon for Val.(b) Do you expect the pI for the sickle-cell b-globin to be higher or lowerthan the pI for wild-type β-globin? Explain
- On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.One of the amino acid sequences in the lysozyme protein from the bacterial virus T4 studiesby Streisinger and co-worker was .... Lys – ser – pro – ser – leu – asn – ala – ala – lys. Thisparticular amino acid was found to have changed to lys – val – his –his –leu –met –ala –ala–lys... as a result of a single nucleotide deletion and addition approximately 15 bases apartin the mRNA. Which base was deleted and which was added? Give the altered sequence of bases inthe altered amino acid.One of the amino acid sequences in the lysozyme protein from the bacterial virus T4 studiesby Streisinger and co-worker was .... Lys – ser – pro – ser – leu – asn – ala – ala – lys. Thisparticular amino acid was found to have changed to lys – val – his –his –leu –met –ala –ala–lys... as a result of a single nucleotide deletion and addition approximately 15 bases apartin the mRNA.a. What is the sequence of the nucleotides that produce the original protein.b. Which base was deleted and which was added? Give the altered sequence of bases inthe altered amino acid.