Reading frame #1 cu G_Gc A U U Gc CUUAU Leu Ala Leu Pro Тyr Reading frame #2 cu G G CA UU G Cc UU AU Trp His Cys Leu Reading frame #3 CUG G CA UUG c CUU AU Gly lle Ala Leu FIGURE 7.13 Reading Frames A nucleotide sequence has three potential reading frames, but only one is typically used for translation.
Q: 3. (i) Referring to the genetic code (the codon usage table), what would be the amino acid sequence…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.
A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…
Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…
A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…
Q: RNA codon table 2nd position G 1st A 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Cys…
A: Three consecutive nitrogen base on mRNA is called genetic code which determine a specific amino…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: DNA ( deoxyribonucleic acid ) is the hereditary material in humans and almost all other organisms.…
Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…
A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…
Q: Examine Table 15-2. The codon AUG codes for the amino acid methionine and also for “start.” What…
A: The genetic code allows DNA and RNA sequences to be decoded into the amino acids of the protein…
Q: Why are some transposons medically important?
A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…
Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…
A: To identify: The mutation in the given DNA sequence
Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…
Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What…
A: As you have posted multiple questions, we are supposed to answer only first 3 subparts. Kindly…
Q: 1. The below strand is a normal polypeptide. Using the below base sequence and amino acids, draw an…
A: AMINO ACIDS --These are the organic molecules ,structural which make up the proteins .The proteins…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…
A: The Genetic code is : 1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…
Q: 38. Adenosine deaminase acting on RNA (ADARS) catalyzes the conversion of Adenosine to Inosine (at…
A: During the purine metabolism, the amino group from adenosine is removed by the enzyme adenosine…
Q: Problem B. DNA: Codon Segmenting The way that DNA is often interpreted as genes is in groups of…
A: An open reading frame (ORF) is the segment of DNA (deoxyribonucleic acid) sequence that can be…
Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…
A: Mutation of amino acids change the primary structure of the protein which affects the protein…
Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…
A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…
Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…
A: There are 4 codons that specify the amino acid valine, demonstrating the genetic code is…
Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…
A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…
Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…
A:
Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…
A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…
Q: o drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA…
A: The central dogma of molecular biology is the process of replication, transcription, and translation…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3' From above sequence…
Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…
A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: DNA Double А A Helix C T C C MRNA A C C C Transcribed TRNA A Anticodon Amino Acid Pro Sequence Amino…
A: DNA has sense and antisense sequence, sense codons have the same bases as that of mRNA except that…
Q: EF-Tu: EF-Ts as ORF-1:RF2 eEF1A:eEF1B O Shine-Dalgarno:5'-7mG O Co-translation: post-translational…
A:
Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…
A: the process shown in the picture above is is protein translation where protein is translated…
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…
A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…
Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’…
A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…
Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…
A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…
Q: Original DNA Sequence: T A C G C A A A A A T C G A T C G A A C T mRNA Sequence: Amino Acid Sequence:…
A: There are various types of mutation that takes place in the DNA sequence among which the three basic…
Q: A TRNA molecule with the anticodon GCU would be carrying the amino acid: Secend ha f cod Three-er…
A: Ribonucleic acid (RNA) comprises a Ribose sugar along with a phosphate group and nitrogenous bases.…
Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…
A: Mutations can be defined as the sudden changes which occur in DNA. These changes can be a result of…
Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…
A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…
Q: Second base of codon C A UUU Phenylalanine UCU UAU UGU Cysteine U Tyrosine tyr y U UUC phe F UCC…
A: The process of protein synthesis is called translation. messenger RNA, transfer RNA and ribosomes…
Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…
A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…
Q: UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Use the first picture and codon table to answer the following questions.
A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…
Q: Which amino acid would you expect a tRNA to be charged with if the TRNA has the anticodon 3' CUG 5'?…
A: Amino acids are biomolecules synthesized by the process of transcription and translation and form…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…
A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA…
A: DNA => mRNA => Protein 64 codons are there for 20 amino acids. That is one amino acid can be…
Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…
A: Ans is.. methionine
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln
Q: Gly Leu (F) (L) Glu Asp (D) Ser (S) Tyr Ala (A) GUC Cys (C) G U Val (M) U GNP (W). Arg (R) G A C Leu…
A: Any change in the genetic material, which is not caused by recombination, that leads to altered…
Why is it important that the correct reading frame is used?
Step by step
Solved in 2 steps
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterWrite the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- AUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letterThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’