Question 9. Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B. A +2 frameshift mutation C. A-3 frameshift mutation D. A-1 frameshift mutation E. A-2 frameshift mutation
Q: A patient was admitted to the ER with severe virulent E. coli bacteremia and was given a high dose…
A: 1. E. coli and its Outer Shell:• Gram-negative bacteria: E. coli falls under this category. Their…
Q: dont provide handwriting solution ...
A: When dealing with circular DNA containing multiple EcoRI recognition sites, the digestion pattern…
Q: consequences of not managing water
A: Key references:…
Q: What is long-term potentiation (LTP) and how does it occur? What changes in the cell should we…
A: Long-term potentiation (LTP) is a persistent increase in synaptic strength that occurs following…
Q: please answer the following: 1. how would each be distributed and please complete the chart2.…
A: which is a diagram about the crossing of Species X and Species Y, here's how the chromosomes would…
Q: STEM Workplace Practices
A: The concept of Design of Experiment (DOE) and how it can be applied in process development.Objective…
Q: Would breathing pure oxygen cause a large increase in oxygen transport by the blood in a healthy…
A: Inhaling pure oxygen can influence a person's body in several ways depending on their overall health…
Q: What type of behavior: A child might stop throwing tantrums after his/her favorite toy is taken away…
A: The objective of the question is to identify the type of behavior exhibited by a child who stops…
Q: List the types of junctions found in animal cells, and state a function for each.
A: Animal cells have special parts called cell junctions that help cells adhere together and talk to…
Q: An athlete tested positive for Methylhexaneamine in urine with a level of 0.90 µg/mL. At her appeal…
A: In competitive sports, the accuracy and reliability of doping tests are fundamental due to their…
Q: When Mendel crossed yellow-seeded and green-seeded pea plants, all the offspring were yellow-seeded.…
A: The allele for yellow seeds should be written in uppercase letters, while the one for green seeds…
Q: Which of the following statement regarding the whole-pathogen vaccine is/are correct (B) Live…
A: In order to tackle this question, it is crucial to comprehend the attributes of live attenuated and…
Q: What is the main factor that differentiates genetic drift from natural selection? 1. Genetic…
A: The main factor that differentiates genetic drift from natural selection lies in the mechanism…
Q: a diagram that shows evolutionary connections between clades is called a_______ . a. karyotype c.…
A: Understanding the links and divergences between different species or groups over time is fundamental…
Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…
A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…
Q: If a population were to remain in Hardy Weinberg Equilibrium, which of the following is correct?…
A: The objective of the question is to identify the correct statement about a population that remains…
Q: Examine the Following key words and examples on the left. Drag the choice from the right that best…
A: Primary Succession: This occurs when a community establishes itself on a previously uninhabited…
Q: Which of the following is NOT true of gas, nutrient, and fluid exchange between capillaries and body…
A: The objective of the question is to identify the incorrect statement about the exchange of gas,…
Q: Genetics Q1
A: The objective of the question is to calculate the number of DNA sequence copies after 29 rounds of…
Q: Snuffle Snork TAC CAA AGA AAT ATT TAC ATG GGT GTT GTC TTC ACT TAC GAG GAT AGC CGC ATC TAC CAA CGA…
A: The objective of this question is to understand how DNA determines the traits of an organism. In…
Q: Air pollution was one of the first areas of environmental concern and regulation. Identify any such…
A: Addressing air pollution comprehensively is crucial not only for safeguarding public health but also…
Q: What does CaMKII do? A. It displaces magnesium and therefore permits glutamate to open calcium…
A: The basic enzyme in neural signalling, calcium/calmodulin-dependent protein kinase II (CaMKII), is…
Q: A graduate student was assaying LD50 (lethal dose 50%) of two temperature-sensitive Francisella…
A: Given:At 20°C: Strain A LD50 = 100, Strain B LD50 = 1000. At 37°C: Strain A LD50 = 1000, Strain B…
Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…
A: The question is asking which of the given options would decrease the uptake of water by a plant root…
Q: How is the brain involved in the regulation of body temperature?
A: Maintaining homeostasis within the human body requires the imperative physiological work of…
Q: List all the antibiotics in the above table that work through destroying the bacterial cell wall.…
A: In addition to the four described above, glycopeptide antibiotics target the bacterial cell wall.…
Q: Repeated white cell counts could be helpful in managing patients who are taking therapeutic agents…
A: The objective of the question is to determine whether repeated white cell counts can be beneficial…
Q: Imagine the unlikely case that the 11 individuals represented in the gel image above were truly…
A: Approach to solving the question: Detailed explanation:According to the numbering system given, the…
Q: A five-year old boy, suffering from running nose, headache and fever, got severe pain in his right…
A: Pathophysiology of Acute Otitis Media (AOM):AOM is an infection of the middle ear, the space behind…
Q: What physical appearance (Solid, liquid, semi-solid) of following Media: Broth tube, agar slant…
A: Agar is a polysaccharide composed of agarose and agaropectin. It is a gelatinous substance used in…
Q: Use the dropdowns to indicate the pattern of methylation and gene expression expected for a…
A: Here's a breakdown of the key points:Somatic cell inheritance: Somatic cells inherit one allele from…
Q: Q 9: What is standard deviation? Why is it useful in anthropometry? Q7: How might sexual dimorphism…
A: Standard deviation is a statistical measurement that describes how spread out or dispersed the…
Q: 2. The following questions refer to the pedigree chart in the figure for a family, some of whose…
A: To answer these genetic questions, I'll break down each scenario, analyze the pedigree charts, and…
Q: In healthy adults, the concentration of glucose in blood is approximately 80 to 110 milligrams per…
A: An fundamental physiological function that keeps the human body's vitality balance stable is blood…
Q: Which stage of the HIV Reproductive Cycle would be most directly blocked if reverse transcriptase…
A: If reverse transcriptase (an enzyme responsible for converting viral RNA into DNA) was unable to…
Q: What are the five mass extinctions of the past and the current theory of the sixth mass extinction?…
A: The objective of the question is to understand the five major mass extinctions that have occurred in…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: The objective of the question is to identify the component that is not necessary during the process…
Q: On a cool day, a crab (a poikilothermic animal) is sleeping on a rock and not consuming any food.…
A: The objective of the question is to understand the effect of temperature on the mass of a…
Q: Name Sofia Falcione P Pedigree Analysis Practice - for each pedigree, write the genotypes of the…
A: 1. **Maple Syrup Urine Disease (MSUD)**: - MSUD is inherited in an autosomal recessive manner,…
Q: Discuss the similarities and differences between the following terms applied in a particular kind of…
A: Forensic examination regularly includes the utilize of different procedures to identify and measure…
Q: Students filled three identical flasks with water and placed elodea, a type of aquatic plant, in…
A: Explanation:The presence of dissolved oxygen in water is closely related to the process of…
Q: ons: On They will select and present a label for a pet food. They will identify on the label each of…
A: 1. **Main Display Panel** - This is typically the front of the package and includes the brand and…
Q: What is the procedure of enzyme formation in our body ? Explain it by drawing.
A: Enzymes are extraordinary chemicals that speed up responses in living things. They are critical for…
Q: everything to know about viruses and bacteria
A: Microorganisms are minute organisms that are not visible to the naked eye and can only be seen under…
Q: plain Constitutive and regulated enzymes with the help of a diagram.
A: In cellular metabolism, enzymes play a pivotal part in helping biochemical responses necessary for…
Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…
A: Wildtype Chromosome: The reference wildtype chromosome is given as "ABCDE-FGHIJK" with the numbers…
Q: 1. The Petri Dish method is used in microbiology to raise bacteria in: a) rapid growth b) pure…
A: Key references: Books
Q: Body openings are lined by mucous membranes where a barrier, covered by mucus, secreted by peptides…
A: Epithelial Cells: These are the cells that line the body's surfaces, including the surfaces of body…
Q: A premature infant typically lacks subcutaneous adipose tis- sue. Also, the surface area of an…
A: A imperative physiological work, thermoregulation, the capacity to regulate body temperature…
Q: What are some factors that make the respiratory system prone (more likely) to infections? What…
A: The respiratory system is susceptible to infections due to various factors, including exposure to…
Step by step
Solved in 2 steps
- Question 10 of 10 Question 10. Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B. A +3 frameshift mutation C. A – 5 frameshift mutation D. A-1 frameshift mutation E. A point mutation in the first position of the codonQuestion 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.Question 8. How is the green fluorescent protein (GFP) attached to the protein for which it serves as a label allowing that protein's dynamic activities to be tracked? A. The GFP itself is attached directly to the coding region of the gene of the protein being studied. B. A recombinant RNA is produced by attaching the GFP mRNA to the mRNA of the desired protein. C. GFP adheres specifically to the desired protein via weak interactions. D. The coding region of the GFP gene is joined to the coding region of the gene that encodes the protein being studied.
- Question 3 Which mutation that would result to a change of amino acid in the polypeptide? O missense mutation nonsense mutation silent mutation O frameshift mutationQUESTION 48 Identify the best match between the mutation description and term. a. Synonymous mutation: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshifts b. Nonsense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence c. Indel: a change in the DNA that changes the codon code from one amino acid to another amino acid d. Missense mutation: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine but does not change the amino acid sequenceQuestion 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
- Question 9 Cancer can be described as v [ Select ] disease which results from a genetic [ Select ] an infectious Select ] cellsQuestion 1: Amino acids are covalently 3'A A-OH attached at site and MRNA binds to site E5 А. В, С B. A, D D-G m²G-À G-A-C-AC D. mC-U-G-U-G С.А, С В D. E, C mG C U-AGAQuestion 1: Look at the following normal and mutant DNA sequences. Normal Sequence (5'-3'): ATG AAC GTT ATC GCA Mutated Sequence (5'-3'): ATG AAT GTC ATC GCA a) What type of mutation has occurred (be specific)? b) Fill in the table for the normal and mutated sequences. Starting with the given 5'-3' sequence, input the complementary DNA, transcribed RNA from the 3'-5' DNA and translated polypeptide sequence for both. Hint: use the codon table! Normal sequence Mutant sequence DNA 5'-3' (given) DNA 3'-5' RNA Polypeptide (use 3 letter codes) c) Based on parts A and B above, what is the ultimate effect this mutation has had on the polypeptide? (1 sentence summary)
- 63. A student studying mutations found her amino acid chain was Met-Ile-Gly-Pro-Pro-Pro-Gln-Tyr-Val-Stop The second "Pro" that should not be there shows the mutation is a mutation. A. Frameshift C. Missense D. Silent B. NonsenseQuestion 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start siteQuestion 1 I . Protein Synthesis – complete the chart for this coding region of a gene. DNA sense ATG AAA CGA GTT ACC GAA ACT TAA DNA nonsense mRNA codon tRNA anticodon Amino acid