Question 4 Listen Tina Is the mother of Violet, Jose, Kelly and Paul. Ramone is a potential father. You are trying to determine which if any children could be the offspring of Ramone Tina Ramone Violet Jose Kelly Paul =- == Gene 1 Gene 2 You analyze 2 genes Gene 1 and Gene 2 known to have variable numbers of repeats. After PCR and gel electrophoresis, you get the results shown above. Based on these results you conclude that Paul a) Must be the offspring of Ramone and and Tina b) Can not be the offspring of Ramone and Tina c) Could be the offspring of Ramone and Tina
Q: ory X Gakg614 micro x Mail - Kayli Je X Google Docs × <for X Xavier Univer x…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: How to solve the genotype, allele, and phenotype frequency.
A: The first step is to compute the allele frequencies: Allele frequencies are numerical…
Q: The rate of plant growth on an island near Isle Royale is such that the carrying capacity of moose…
A: 1. Initial conditions: Initially, there are 450 moose on the island, and the environment is stable…
Q: Identify the Genus
A: The figure shows the growth of Rhizopus in a lactophenol cotton blue stain culture.Domain:…
Q: How can I solve this equation?
A: Given, Every time the bacteria reproduce, the number doubles. Which means, it represents an…
Q: In the case of Per3, there is a 54-base pair sequence that is repeated 4 times in one allele, and 5…
A: Research on the Per3 gene, which includes a variable number repeat of a 54-base pair (bp) sequence,…
Q: This pedigree traces the inheritance of a trait in humans. Based on this pedigree, is the allele for…
A: • Recessive: parents are carriers but not affected, both must contribute the recessive allele for…
Q: One example of innovation from an unexpected source came from the study of tumor-like plant growths…
A: The correct answer is:- The ability of Agrobacterium tumefaciens to integrate its genes into the…
Q: Discuss reuptake and enzymatic degradation (breakdown) in the context of the appropriate…
A: The response delves into the intricate processes of neurotransmitter regulation, focusing on…
Q: A bacterial strain is growing exponentially. At 1:00pm the titre of the culture is 2x10^3 cells per…
A: The objective of the question is to determine the number of generations that have elapsed, the…
Q: . Some years ago, the CDC noticed a puzzling trend: Reported cases of salmonellosis seemed to soar…
A: Regarding the seasonal trends in reported cases of salmonellosis, the Centers for Disease Control…
Q: Although the virus that causes smallpox has been eradicated, there are still stocks of the virus,…
A: The objective of the question is to understand the reasons why someone might argue for the…
Q: prokaryote is characterized by dispersed dna and lack of membrane bound organelle abesence of…
A: The question is asking us to identify the characteristics that define a prokaryote. Prokaryotes are…
Q: What did Darwin observe regarding finches on different islands in the Galapagos? Different beak…
A: Choice B Explanation:Darwin noted that the various beak forms and sizes of finches on the various…
Q: Lab Report 3 Specimens (1 Representative Species each) for: • Phylum Platyhelminthes: Class…
A: Let's delve deeper into each of the specimens listed in the lab report, providing a thorough…
Q: Can someone explain explain how the silent and missense mutations are different from each other? I…
A: Frameshift mutations and nonsense mutations are two forms of genetic mutations that can cause…
Q: You have 3 populations inhabiting the same landmass. Individuals from the first and second…
A: The biological species concept defines a species as a group of interbreeding individuals that are…
Q: Marasmus is associated with ____. a. changes in skin and hair pigmentation b.…
A: The question is asking to identify the symptom that is associated with Marasmus, a severe form of…
Q: If I give you three species- a bacterium, an algae and an animal, which two species are more likely…
A: The objective of the question is to identify which two out of the three given species - a bacterium,…
Q: Genetics Q5
A: The objective of the question is to identify the correct definition of IPS cells among the given…
Q: You cross a fruit fly with long wings (L) to one with short wings (l), and out of over 100…
A: Solution:Determining the Genotypes of the ParentsTo determine the genotypes of the parents, we can…
Q: I need help with this question please
A: During the G1 phase of the cell cycle, Cyclin-Dependent Kinase (CDK) complexes prepare for the…
Q: 8. Your organization must investigate ALL claims of harassment it receives. TRUE FALSE
A: TRUE. Organizations are legally and ethically obligated to investigate all claims of harassment they…
Q: 6. To be considered national origin harassment, which of the following statements is correct? The…
A: The harassment victim's native language must not be English. - This statement is incorrect. National…
Q: Pierre Simon de Laplace claimed that all of the following planets in our solar system are older than…
A: According to Pierre Simon de Laplace's theory, Mercury is the youngest planet in our solar system.…
Q: Location of headache is very relevant when exploring different types of headaches, explain why this…
A: The location of a headache can be a crucial clue in identifying the type of headache a person is…
Q: How do oxygen minimum zones (OMZs) which are subject to constantly low concentrations of oxygen,…
A: The development of Oxygen Minimum Zones (OMZs) is a complex process that involves both biological…
Q: Find an occurence where a biomechanical therory or concept was being used in a tv show/advertisement…
A: a) One example of a biomechanical theory being used in a TV show is in an episode of "MythBusters."…
Q: Which species on the chart (A,B,C,D,E,F,) is the common ancestor
A: Using the above figure, Species A is the common ancestor because all the other species are descended…
Q: What is the simplest way to solve this? Please give me a step by step explanation.
A: To solve this problem, you need to convert the given measurement from meters to micrometers.Here's a…
Q: Consider the audibility curves in the graph above. Suppose all animals listed in the graph are…
A: So, the correct statements appear to be: C. A sound of 10,000 Hz would need greater amplitude than…
Q: Explain anatomy of human body?
A: Building Blocks:• Cells:The human body is estimated to be composed of around 37 trillion cells!…
Q: Which of the following media is capable of detecting all clinically significant antibodies while…
A: The question is asking us to identify the medium that can detect all clinically significant…
Q: Mutation a change in the DNA Point mutations - when a single nitrogen base is deleted, inserted or…
A: The key information we need for understanding mutation is the specific base pairings. The specific…
Q: The question is:
A: Approach to solving the question: I hope this helps!! Detailed explanation: Examples: Key…
Q: Is the variation associated with lactose tolerance found always on one chromosome, bothchromosomes,…
A: The question is asking about the genetic basis of lactose tolerance, specifically where the…
Q: what is the simplest way to solve this? please give me a step by step explanation.
A: To find the difference in order of magnitude between the sizes of the megakaryocyte and the…
Q: Be sure to answer all parts. Calculate the equilibrium constants for decomposition of the following…
A: To calculate the equilibrium constants (K) for the decomposition of hydrogen halides into hydrogen…
Q: Can you please explain the Physical and Chemical action of Sertraline?
A: Sertraline is a type of antidepressant known as a Selective Serotonin Reuptake Inhibitor (SSRI). It…
Q: How do we reduce the use of pesticides in farming?
A: The objective of the question is to understand the various methods that can be employed to reduce…
Q: 3. Which should be considered when a person becomes incontinent? Decrease in caffeine intake…
A: The answer provided above is a detailed explanation of the factors that should be considered when a…
Q: Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of…
A: Step 1: The order of the steps required to sequence a region of DNA using dideoxy sequencing…
Q: Chimpanzees have been observed making and using tools in the wild. True or false?
A: The question is asking whether it is true or false that chimpanzees have been observed making and…
Q: 10. Why should employers be especially careful about harassment when sponsoring social events such…
A: Employers should be especially careful about harassment when sponsoring social events such as…
Q: 9. What does a person with Alzheimer’s disease have difficulty within the early stage? Changing…
A: Answer well explained above
Q: Match the following terms with the best description. Question 7 options: The…
A: The objective of the question is to match the given terms with their appropriate descriptions.
Q: In winter, in cold temperate lakes, the warmest water usually occurs: Group of answer choices at…
A: The question is asking about the distribution of temperature in a cold temperate lake during winter.…
Q: Select a theory or concept from biomechanics and discuss how you can apply it when having a job as a…
A: Joint Mobilization and Physical Therapya) Biomechanical Theory: Joint MobilizationJoint mobilization…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: Multiple fission within the parental bacterial cell leads to a formation called: a) Glial tissue b)…
A: The question is asking about the result of multiple fission in a bacterial cell. Multiple fission is…
GQ4
Step by step
Solved in 2 steps
- | Choose J [Choose] repetitive DNA transposable elements transposon retrotransposon pseudogenesJoe is heterozygous for a dominant genetic disease. His wife, Jenny does not have the disease. They have 5 children of which 2 (Jim and Jan) have the disease and 3 (Jose, Jerry and Julie) do not. DNA from each individual is isolated and analyzed by PCR an gel electrophoresis. 3 variable markers are studied. The results for each marker are shown here. The numbers to the left of each gel represent size in hundreds of bases Jim Jose Marker 1 Marker 2 Marker 1 Jenny Joe Marker 3 Jan Jerry Julie Jim Jose Marker 2 Jenny Joe Jan Jerry Julie Jim Jose Marker 3 Jenny Joe Based on these results, which marker is most likely associated with the condition? Jan Jerry JulieQUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damaged
- QUESTION 49 You have discovered a very small amount of DNA from an ancient organism that you want to save and study. What is the very first thing you should do to allow you to study this DNA in the lab? O a. Insert the DNA into a vector Ob.RT-PCR Oc. Gel electrophoresis. O d.PCR Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers Save and Submit ScieQuestion 32 Enzyme that combines the 2 DNA fragments from different organisms Recombinant DNA Technology Restriction enzymes O Ligase O Palindromic sequencesQuestion 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.
- Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…b) Among the progeny from the Hfr3 mating above, you find one that has the genotype: Abc de F Draw out the gene transfer and crossover(s) that produced this outcome: c) Among the progeny from the Hfr3 mating above, you find one that has the genotype: A B c d e f Draw out the gene transfer and crossover(s) that produced this outcome:QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
- QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 31 Match each of the following terms to the most appropriate description. A. the DNA sequence recognized by a particular endonuclease v CRISPR B. a somatic cell, such as a fibroblast, that is converted into a stem cell v Transcriptome a chemical that can light up a specific color when viewed under special types С. of microscopes v plasmid D. The entire MRNA content of a cell or tissue v restriction site A bacterial enzyme that can be programmed to recognize and cut DNA at a E. v Flourophore specific sequence v IPSC F. A DNA triplet that transcribes into an MRNA start codon v nucleic acid probe G. a circular piece of DNA that is used to carry genes from one cell to another A small, radioactive or fluroescently-labeled piece of DNA used to detect a Н. specific gene by binding to it v ATGQUESTION 1 In this gel, PCR is performed using primers outside of the repeat area anf the product is then run on a gel. Which of these alleles would be the lowest band and which would be the highest band when run on a gel (remember how electrophoresis works!!) ALLELES #1 -CACACACACACACACACACACACACACACA -CACACACACACACACACACACACACACACACACA # 2 # 3 -CACACACACACACACACACACACACACACACACACA- GENOTYPES 1 2 3 4 5 6. O 1 is lowest band and 3 is the highest band O 3 is lowest band and 1 is the highest band O 1 is the lowest band and 2 is the highest band