Provide a brief overview of Environmental Concerns, Impacts, and Sustainablllty of Coastal Fishing Provide insight into Indeginous perspectives, collaborations, oppositions, and impacts of colonial Canada's use of this Coastal Fishing
Q: Tabulate the results of your two-point threshold experiment and produce the homunculus.
A: Answer
Q: Most of the carbon dioxide that plants use for photosynthesis comes from______ . a. glucose c. rainw...
A: photosynthesis is the process that plants use to turn carbon dioxide and water into glucose and oxyg...
Q: which lampreys are native and which are invasive to the Great Lakes?
A: Sea Lamprey are native and which are invasive to the Great Lakes. The earliest sighting of a sea lam...
Q: What is a redox reaction?
A:
Q: Which letter is correct A. Genetic engineering is preferred because a desired gene to crops may not...
A: There are few points about genetic engineering and conventional farming. Genetic engineering is als...
Q: A science teacher wants to test the effectiveness of two types of learning strategies. She uses a fl...
A: Introduction A language learning strategy refers to the processes and actions that language learners...
Q: Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a. Fix...
A: Coding sequence codes for functional protein products. Coding sequence codes for the functional prot...
Q: Explain Affinities of Gnetales.
A:
Q: The extinction of dinosaurs left gaps in the early ecosystems on earth. Explain briefly the aftermat...
A: Evolution is change in the species over a period of time.
Q: Standard of precautions provide guidelines for the purpose of; I. Eliminating the source of infectio...
A: Standard of precautions provide guidelines to prevent spreading of disease transmission (patient to ...
Q: What type of biome do you live in? (If you live in adeveloped area, what type of biome was the area ...
A: Humans can be found in almost every type of terrestrial biome on the earth. Of the Earth's 6.4 billi...
Q: Dr. Krishna at CSU has been conducting research on snake venom. Similar to Dr. Krishna, a scientist ...
A: clusturing of species arises whether species coexist by partitioning resources, environmental prefe...
Q: How does the swim bladder varies in different aquatic environments?
A: The swim bladder or air bladder is an internal gas filled organ that contributes to the ability to c...
Q: A circulatory system moves all of these things through an animal's body, but which is most important...
A: The physiological process by which digested food materials, oxygen, etc., are distributed throughout...
Q: Discuss the process of evolution through natural selection. What could happen to the ecosystem and a...
A: Evolution is the most fundamental and organizing principles of the biological sciences and as such i...
Q: A) Explain why we use the concept of Hardy-Weinberg Equilibrium if populations are never stable? B) ...
A: When a population is in Hardy-Weinberg equilibrium for a gene, it is not evolving, and allele freque...
Q: Cite and explain the factors that led to an enormous bloom of animal diversity in the Paleozoic era.
A: Paleozoic era began somewhere around 541 million years ago and ended around 252 million years. The ...
Q: that discusses the Polarized state (mV inside the neuron, ions present/abundant inside and outside, ...
A: A plasma membrane surrounds a neuron, much like any other cell, and it is semi-permeable, allowing o...
Q: Why is the last asymmetric carbon used to establish D/L configuration? Is this an arbitrary choice o...
A: In carbohydrates, those molecules show mirror image is known as enantiomers. It shows absolute conf...
Q: While doing research on deep-sea vents, you discover a very simple new life form. After some initial...
A: DNA is the fundamental component of our being. DNA is the carrier of information, it passes from one...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: What is the key concept for this section? What isHIPPCO? What is the greatest threat to wild species...
A: Ecology is the study of how living organisms, such as people, interact with their surroundings. Huma...
Q: A homozygnous Dominant brown mouse is crossed with a heterozynous Brown mouse(tan is ressesive color...
A: A gene is a piece of DNA that contains the instructions for a specific feature or attribute. Heteroz...
Q: Describe one medical/ethical issue that was raised in your lifetime involving politics. How was poli...
A: In light of the recent pandemic that has created shockwaves globally, disruptions pertaining to the ...
Q: Explain how the three major types of deserts differin their climate and vegetation. Why are desert e...
A: Hi! Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a...
Q: Which type of evidence for evolution is most accurate in determining evolutionary relationships–morp...
A: In biology, evolution refers to changes in an organism' features over numerous generations as a resu...
Q: what does rennin do in the context of food?
A: Rennin also called as the chymosin is the protein digesting enzyme that curdles the milk by transfor...
Q: Catalase combines two hydrogen peroxide molecules(H2O2 + H2O2) to make two molecules of water. A gas...
A:
Q: Which level(s) of protein structure can you find the α helix and the β pleated sheet? mutiple answer...
A: The Beta-pleated sheet is made up of anti-parallel chains of covalently linked amino acids with hydr...
Q: Contrast positive versus negative control of gene expression?
A: Introduction :- Gene expression is the process through which information from a gene is used to crea...
Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...
A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...
Q: Study the graphs shown in the picture. Describe the patterns observed in the top group depicting ch...
A: Biodiversity refers to the variety of life on earth at ecosystem, genetic and species levels.
Q: Explain your answer. Below is a pedigree showing the inheritance of colorblindness in Akoto family. ...
A: Colour blindness is a color vision deficiency, and a reduced ability of not distinguishing between c...
Q: A tree grows and increases its mass. Explain why thisis not a violation of the law of conservation o...
A: Atoms are the smallest things that are designed to be considered as the basic building blocks of the...
Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...
A: Genetics is the discipline of science concerned with the study of genes and their transmission from ...
Q: 3. Explain the term Refractive Index (n) of liquids, and describe how the values may be measured exp...
A: Refractive index It determines how much light is bent, or refracted when entering a material. When l...
Q: Perform the Fork-lined method of the given alleles. A male having a characteristic of TtSsYy and a ...
A: Genetics is the study of the functioning and main codes of variation and heredity. Inheritance is th...
Q: What is the number and types of lamprey species that are present in the Great lakes?
A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...
Q: Name three important functions of DNA.
A: DNA is deoxyribonucleic acid which acts as genetic material in all organisms present on Earth. DNA i...
Q: Basic Alternation of Generations. What are the structures in plant life cycle that are haploid?
A: Alternation of generations means that the plant's life cycles alternate between diploid (sporophyte)...
Q: Given the highly complex lipid composition of cell membranes, what are the variations within differe...
A: Cells are membrane-bound structure that contains the organelles of the living body. Some of the cell...
Q: 1. You need to lower an injured friend from a building. His injury is located on his chest. Which of...
A: All the given question are provided us as a situation and we have to choose the right method accordi...
Q: Can you please interpret and discuss and mark, this gel electrophoresis results. DNA ladder sizes:...
A: A molecular-weight/ size marker, also referred to as a DNA ladder, is a set of standards that are us...
Q: Summarize Theodor Engelmann’s photosynthesis experiment
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: Sex-linked inheritance
A: Glucose-6-phosphate dehydrogenase deficiency/G6PDD (g) is an X-linked recessive condition. Fragile ...
Q: Subdivisions of geologic Time.
A: 1 ) cenozoic era ,time interval- 66 million years to present , duration - 66 million year % geologic...
Q: phylogenetic tree?
A: Phylogenetics is a branch of biology that deals with studying and determining the evolutionary relat...
Q: Provide a proof that a different phenotype can be produced from the same genotype. What are the pos...
A: The collection of genes that make up a person's genotype is referred to as that person's genotype. I...
Q: it
A: Warrier and her collaborator, Jessica Hendy and archaeological scientist at the University of York, ...
Step by step
Solved in 2 steps
- Suggest two reasons why the sustainable management of fishery resources is more of a challenge than the management of either agricultural or forestry resources.List and discuss three policies that could be used to encourage sustainable fishery management.Explain the following: Fishing regulations, limits, and seasons are among the best solutions to preventing overuse of fishery resources and allow all Filipino to enjoy fishing and apply your knowledge to recommend another solution to potentially harmful environmental changes within aquatic ecosystems in Filipino
- About adaptation plans, which of the following sentences are NOT true? Select two or more: In the existence of a sector-specific adaptation plan for fisheries and aquaculture, it becomes less relevant for the sector to be included in a broader adaptation planning process. The mainstreaming of fisheries and aquaculture issues in national adaptation processes is improving but often remains incomplete and superficial. The mainstreaming of fisheries and aquaculture issues in national adaptation processes has been successfully completed due to global efforts in compliance with the Paris Agreement. It is necessary to have a sector-specific adaptation plan for fisheries and aquaculture.Which of the following is not part of the attempt to address overfishing by the Magnuson-Stevens Fishery Conservation and Management Reauthorization Act? a) Establishing quotas for fishing b) Research on marine environments c) Compensation for sustainable fishing practices d) Setting aside 200 nautical miles of the U.S. coast1) Describe some of the specific forest management techniques/strategies that are being currently used to balance wildlife habitat/water quality with logging timber. 2) Describe at least 3 major impacts to salmon caused by Logging, Agriculture and Development in terms of the part of their life cycle that is impacted.
- About the adaptation toolbox, which one of the following sentences is NOT true? Select one: Livelihoods adaptation includes a mix of public and private activities within the fisheries and aquaculture sector, as well as non-fish related sectors. There is no guidance available specifically aimed at developing adaptation strategies for the fisheries and aquaculture sector. Institutional frameworks can be created or revised to ensure effective stakeholder participation and to enhance cooperation mechanisms between countries and other stakeholders. Tools for risk reduction and resilience building aim to improve preparedness for and response to climate change impacts.For each of the following environmental problems, please list two potential steps that can be taken to reduce negative effects: 1. Impacts of invasive species 2. Impacts of pollutionwhat is the impact of or the importance of the study about IOT based Aquaponics Monitoring and Automated Control System/simple aquaponics to the Fish and Aquatic Resources Community
- What are the top 3 hazards posed by alien invasive species? Also provide a list of invasive species of federal capital and their individual management proposed by different agencies.Name three industrial fishing practices, and explain how they result in bycatch and marine habitat degradation.Environmental scientists David Pimentel, Rodolfo Zuniga, and Doug Morrison of Cornell University reviewed scientific estimates for the economic and ecological costs imposed by introduced and invasive species in the United States. They found that, as of 2005, approximately 50,000 species had been introduced in the United States and that these accountedfor over $120 billion in economic costs each year. These costs include direct losses and damage, as well as costs required to control the species. (The researchers did not quantify monetary estimates for losses of biodiversity, ecosystem services, and aesthetics, which they said would drive total costs several times higher.) Calculate values missing from the table to determine the number of introduced species of each type of organism and the annual cost that each imposes on our economy. Of the 50,000 species introduced into the UnitedStates, half are plants. Describe two ways in whichnon-native plants might be brought to a new location.How…