O Off target effects are not really a concern. Question 20 What happens after a double stranded break is induced in the DNA? Select the statement that is FALSE. O HR which will lead to a small indel if template DNA is absent O Microhomology-Mediated End Joining O Non-Homologous End Joining O HR if template DNA is present Question 21 See below for four STR profiles from four different boys, as depicted in an electropherogram. The peak local
Q: A five-year old boy, suffering from running nose, headache and fever, got severe pain in his right…
A: Pathophysiology of Acute Otitis Media (AOM):AOM is an infection of the middle ear, the space behind…
Q: ents 2 Due Monday by 11:59pm Points 10 Submitting an external tool Available Apr 22 at 12am - Apr 24…
A: Based on the image you sent, it appears to be a pedigree chart for a genetic disorder. The pedigree…
Q: The gene known to be mutated in cases of Agammaglobulinemia 2 (which is inherited in an autosomal…
A: The Agammaglobulinemia is an Autosomal recessive condition.The Agammaglobulinemia 2 is present on…
Q: When discussing natural selection and behaviour, we often say that members of a species have certain…
A: Without a doubt! In order to have a better grasp of the connection between natural selection and…
Q: Discuss some of the health benefits of sleep during infancy and how long children need to sleep for?
A: References:Mason GM, Lokhandwala S, Riggins T, Spencer RMC. Sleep and human cognitive development.…
Q: what is the simplest way to solve this? please give me a step by step explanation.
A: To find the difference in order of magnitude between the sizes of the megakaryocyte and the…
Q: What are food sources of Omega -3 (alpha-linolenic acid)? What are food sources of Omega-6 (linoleic…
A: Food Sources of Omega-3 (Alpha-Linolenic Acid)Omega-3 fatty acids are essential nutrients that play…
Q: which of the following models represents the genetic material that controls inherited traits
A: The DNA model is the model that represents the genetic material responsible for inheriting traits.…
Q: CRISPR-cas9 is a powerful technique for gene editing. Please place the stages of a CRISPR-cas9 gene…
A: The following is a strategy for answering the question: 1. Gain an understanding of the processes…
Q: Think about a forest. Cultural services we get from the forest include is and One provisioning…
A: Approach to solving the question: Considering all the given options, a solution has been initiated…
Q: Rainforest plants from which we extract medicines would be considered as a provisioning service.…
A: A provisioning service is any type of benefit to people that can be extracted from nature. Along…
Q: How could surgical resection of the ileum impact liver function? Consider the intricate interplay…
A: References:Onufer EJ, Han YH, Courtney C, Steinberger A, Tecos M, Sutton S, Sescleifer A, Ou J,…
Q: having extra digits is a dominant trait. a man has extra digits while his wife and their daughter…
A: 1. **Genotypes of the Parents**: - The man has extra digits, so he must have at least one dominant…
Q: Help with question 40
A: 1. Blocks spatial buffering of K+ by astrocytes - This would likely lead to an increase in neuronal…
Q: The figure below represents two DNA molecules, with polarities as indicated. The dashed block shows…
A:
Q: having extra digits is a dominant trait. a man has extra digits while his wife and their daughter…
A: The objective of this question is to determine the probability of the couple's next child having…
Q: You cross a fruit fly with long wings (L) to one with short wings (l), and out of over 100…
A: Solution:Determining the Genotypes of the ParentsTo determine the genotypes of the parents, we can…
Q: Match the following terms with the best description. Question 6 options: A…
A: The objective of the question is to match the given terms with their correct descriptions.
Q: 37) What is the name of the organism that makes alcohol from sugar? 38) How does salting preserve…
A: Of course, let's delve deeper into each topic:37. Yeast Fermentation: Yeast is a type of…
Q: Please answer this four question it Anthro work. Please do it now
A: Approach to solving the question: Detailed explanation:1. B2. Traits:Shape and Size: Human bones…
Q: Experiment A microarray was hybridized with a mixture of two differentially labeled fluorescent…
A: I based my response on the experimental setup described in the prompt. In the experiment, two…
Q: How do oxygen minimum zones (OMZs) which are subject to constantly low concentrations of oxygen,…
A: The development of Oxygen Minimum Zones (OMZs) is a complex process that involves both biological…
Q: A young child (2 years old) has developed a nasty chest cold that has lasted for nearly 2 weeks, and…
A: 1. Disease and Infectious Agent: Pertussis, commonly known as whooping cough, is a highly contagious…
Q: I need help with this question please
A: During the G1 phase of the cell cycle, Cyclin-Dependent Kinase (CDK) complexes prepare for the…
Q: 26-27) List all the antibiotics in the above table that work through inhibiting replication (if…
A: Self explanatoryHope the answer was helpful. If any doubts feel free to ask for further…
Q: 21) Define the term antibiotic 22) What is the name of the circle formed around each of the discs…
A: Key references: books
Q: Repeat the procedure to collect data on the plates containing E. coli (Figure 4). Record the results…
A: Step 1: **Substances*** E. Coli-containing Petri dish * Six distinct antimicrobial agents *…
Q: Case 4: A man in his early 20's has come to the emergency room complaining of painful urination…
A: Note: Hello, student. I sincerely hope I was able to answer your question. If you have any more…
Q: Evaluating the positive and negative effects stress has on the human body 1. Does stress affect our…
A: Approach to solving the question: In exploring the question of whether stress affects our ability to…
Q: Which is NOT true about Homo habilis: A) considered the first tool maker B) had a smaller brain the…
A: The question is asking us to identify the incorrect statement about Homo habilis, an early human…
Q: simple cases of skin cancer can be treated by Select one: a. dermatologist b. neurologist c.…
A: To sum up, dermatologists are the main medical specialists in charge of identifying, managing, and…
Q: Question 13 Which of the following is TRUE about whole-genome shotgun sequencing? O The first…
A: The first published human genome used the whole-genome shotgun sequencing technique. TRUE - Craig…
Q: of the given answers What are the possible sex chromosome combinations for children with the…
A: The question is asking about the possible sex chromosome combinations in children with congenital…
Q: help
A: Answer 3True. Some food allergies do have a genetic component. People with a family history of…
Q: Find an occurence where a biomechanical therory or concept was being used in a tv show/advertisement…
A: Biomechanics in Action: Exploring "The Six Million Dollar Man"The 1960s television series "The Six…
Q: Can stress be addictive, when looking at the positive and negative effects of stress on the human…
A: The answer delves into the nuanced concept of stress as potentially addictive, examining both its…
Q: fully explain using in-text citations from peer-reviwed journals when the right time to mine the…
A: Approach to solving the question:The right time to mine the seafloor for polymetallic nodules was…
Q: Below is a life table for a hypothetical organism. What is the expected lifetime reproductive…
A: 1) The answer is 2.64.To calculate the expected lifetime reproductive success for individuals…
Q: Humans share almost 99% of our DNA with chimpanzees and bonobos. True or false?
A: The objective of the question is to verify the statement that humans share almost 99% of our DNA…
Q: Safia and Mia investigate floating. They use six identical small containers with lids. Safia puts a…
A: As mass of the sand (g) increases, the distance above the water (cm) decreases. As the mass rose…
Q: (5) 4 (5) 3 6 2 (5) (5) 1 2n n 12 10 11 In the figure, which number represents a zygote? 3 7 1 11 8.…
A: The zygote is diploid (2n) carrying two sets of chromosomes from two parents. In sexual…
Q: State the percentage range of the fresh weight of animals that is made up of water, and situate…
A: The objective of the question is to understand the percentage of water that makes up the fresh…
Q: Learning task 3 lets identify the latitude and longitude
A: Sources:https://gisgeography.com/latitude-longitude-coordinates/https://www.latlong.net/c/?lat=0.000…
Q: Answer the following questions about insulin: Describe DNA methylation and how it impacts gene…
A: Approach to solving the question:Read and understand the question.Answer the questions by…
Q: 2. The following questions refer to the pedigree chart in the figure for a family, some of whose…
A: To answer these genetic questions, I'll break down each scenario, analyze the pedigree charts, and…
Q: 7. Consider the following plasmid (size 6700 bp), with restriction sites at the positions indicated:…
A: Approach to solving the question:Steps in answering number 6:Understand the Enzymes and their…
Q: Recently, more than three dozen cases of food poisoning/ infection were reported after a political…
A: As a member of the City Health Department, my role would likely be that of an epidemiologist or a…
Q: Q 7: What is the function of the nuchal crest? Which species have a pronounced one and what does…
A: Approach to solving the question: Comprehensive analysis provided as per the topic mentioned in the…
Q: Your collaborator from Fisk University has isolated proteins from healthy prostate cancer cells.…
A: <p>First, you need to quantify the proteins isolated from both healthy and prostate cancer…
Q: During a routine exam, Jessica has some blood taken and analyzed. The results show a high IgM titer…
A: IgM and IgG Antibodies:The body produces antibodies to start an immune response in response to…
Step by step
Solved in 2 steps
- Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?
- Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.to 4 minutes) The schematic diagram below shows organization of the DNA replication fork. Match parts of the diagram (labeled A-F) with the corresponding term from the answer list (designated 31 parental duplex 5' 3' fork progression v A 1Lagging strand 2. An Okazaki tragment 3.Site of action of DNA topoisomerase 4 Leading strand 5. Site of action of DNA helicCase 6.Site of action of DNA ligaseAnswer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب
- ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…nand portable. 6.5 mm micro-edge 16405U processon USE YOUR SMARTPHONE w micro-edge display design See dnclamers on product bo Revi Vide Fea Sameness and Variety (Mitosis and Meiosis) 161 Spe Example Sup SCAN Expressed using apples, DNA replication looks like this. Go look at the model of DNA on the demonstration table. We have been presenting DNA as a straight ladder, but actually it is twisted on itself like a spiral staircase. This shape is called a heliz. Observe The Chromosome Normally DNA exists as loose strands (chromatin) in the nucleus of a cell. This nuclear DNA sends a message (RNA) to the ribosomes where protein and enzymes are synthesized. When stretched out, the length of one DNA molecule in a human cell is almost 4 cm. However, the cell itself is but a tiny fraction of that size. During cell reproduction the DNA must be able to move around. So it shortens its length by tightly coiling up. In doing so, the DNA strands become wider and are visible under a microscope.…Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNACynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G