Match the common name of the animal with its most correct taxon by pulling down to the correct answer. toad caecilian salamander [Choose ] ✓ [Choose ] order Anura order Gymnophiona order Urodela
Q: 3. Identify the 2 components of the Eukaryotic cell resulting from primary endosymbiosis and name…
A: Endosymbiosis as a Concept:The term endosymbiosis refers to a symbiotic relationship between two…
Q: https://lupusla.org/ana-test-for-lupus-diagnosis-what-you-need-to-know/ Ella Baker is the name of…
A: An annotated bibliography is a compilation of sources with a brief summary and analysis of each…
Q: Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E.…
A: The addition of IPTG to E. coli BL21(DE3) cells containing the pET-28a-OXA-M290 plasmid induces the…
Q: It is important that a cell checks itself as it moves through the cell cycle. For instance, if…
A: The cell cycle is a meticulously orchestrated process that ensures the healthy replication of cells.…
Q: s from the Answer Bank to label the diagram according to hypothesis 1 on the origin of the…
A: These images represents endosymbiotic event that occurred in the past. In this event the development…
Q: Gaseous Exchange in Vertebrates. Vertebrates Agnathans Chondrichthyes Osteichthyes Amphibians…
A: The act of taking in oxygen and exhaling carbon dioxide is usually referred to as respiration.…
Q: Part II. for a single DNA marker. Below that is a diagram representing the chromosomes of these same…
A: The image and graph, alluding to are part of a genotyping process, which may be a way to analyze the…
Q: a. What is your p-value for your ANOVA test (found in the ANOVA Summary table)? 0.36 b. What does…
A: As the above question does not discretely specify the degrees of freedom for the numerator…
Q: Identify this tissue. Select one: a. Epithelial, simple, squamous b. Epithelial, simple, cuboidal…
A: In the image we can see the elongated cells and the image of part of alimentary canal including…
Q: Only typed answer otherwise leave it Compare a-keratin and hemoglobin with regard to each of the…
A: α-keratin and hemoglobin are two essential proteins found in the human body, each playing a distinct…
Q: A researcher is interested in the geographic ranges of two types of mountain ground squirrels that…
A: A biological interaction in ecology refers to the impact that coexisting species have on one…
Q: For the following sets of partial diploid bacteria, how do I fill out this table? I am not sure how…
A: The method of identifying bacteria frequently includes observing their behavior beneath diverse…
Q: For this experiment, you will be able to manipulate only one variable. First, the amount of water;…
A: The method of scientific inquiry regularly includes the plan and execution of experiments. In this…
Q: This figure comes from an article about predicting protein structures with a multiplayer online ame…
A: Based on the figure and the descriptions you have provided, here is a summary of the trends and…
Q: Discuss the Structures which prevent regurgitation of food in vertebrates
A: In vertebrates, several structures and mechanisms work together to prevent regurgitation of food…
Q: Is erythro and threo the same as zusammen and entgegen? Please explain the differences if any.
A: Erythro" and "threo" are terms used in organic chemistry to describe the relative stereochemistry of…
Q: Both cytosines in the top strand of the following sequence are converted from the 'keto' tautomer to…
A: Tautomerism is a phenomenon referred to as a single compound ables to form an interconvertible…
Q: Gaseous Exchange in Invertebrates Complete the table. Invertebrates Mode of respiration Protozoans…
A: The animals that lacks back bone or vertebral column in contrast to the bone or cartilaginous…
Q: Question 1 Turning a gene on refers to A) causing that gene to light up B) activating the gene's…
A: Chromosomes are the genetic components that transmit characteristics or qualities from parents to…
Q: Competition for limited parking spaces in a UA parking garage is (usually!): Interspecific…
A: In community eclogogy, competition is the type of biological interaction between organisms or…
Q: esterol is the product of the to NADP+.
A: The conversion of 7-dehydrocholesterol to cholesterol involves a series of enzymatic mechanisms in…
Q: Could we potentially make cells immortal, thus making humans immortal? The Turritopsis dohrnii, is a…
A: The concept of cell immortality refers to the ability of cells to avoid the typical processes of…
Q: 7. Instead of one big square it is much easier to make two small Punnett squares, one for each gene.…
A: The inheritance of an "A" or "a" allele is not influenced by the inheritance of a "B" or "b" allele…
Q: After digesting the DNA produced by PCR (generated using the primers mentioned in question 2 added…
A: DNA (deoxyribonucleic acid) is a molecule that contains the genetic instructions for building and…
Q: Which of the following statements is true? a)Having one STI increases a person's risk for…
A: The objective of the question is to identify the correct statement about sexually transmitted…
Q: For which of the following reactions is the AH for the reaction not equal to the AH, of the product?
A: In cooking—when you mix ingredients to make something, the heat you feel might not just come from…
Q: Consider two genes A and B. If there are on average 1.5 crossovers taking place between A and B,…
A: A map unit is defined as the distance between two genes on a chromosome that results in an average…
Q: why should contraceptives be free
A: The question is asking for reasons why contraceptives should be provided for free. Contraceptives…
Q: ATP
A: Cellular respiration:All living organisms, have cells that carry out cellular respiration..During…
Q: Which of the following is NOT a function of proteins in the human body? A. Energy source B. Signal…
A: Proteins are naturally occurring, complex substances that play critical roles in our body. Proteins…
Q: How is the oxidase test performed? Using Kovac’s reagent swab
A: The oxidase test is a microbiological test used to identify bacteria that produce the enzyme…
Q: The small molecule cyclic AMP (CAMP) takes about 0.2 second to diffuse 10 µm, on average, in a cell.…
A: The question inquired about the time it takes for a small molecule, cyclic AMP (cAMP), to diffuse…
Q: Which of the following is the specific gene that is most often used for DNA Barcoding of animals?…
A: Animal DNA barcoding is a biological method that allows species identification and differentiation…
Q: Based on the information shown (picture) draw the pedigree for this family in the space provided…
A: The task at hand involves constructing a pedigree chart for a family, based on a detailed family…
Q: Which of the following would NOT be considered an example of a type of connective tissue? blood…
A: This question dives into the field of histology, particularly focusing on the classification of…
Q: 1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a…
A: In the unique ecological setting of the Namib Desert, the interplay between an organism's physical…
Q: 5' GTATGTTACGTAACCTCTGCCTGCTAAGGGTAGAATATAGCTACGCTATCGATGGTAGCTAGCGATCG 3' a b с 29) Examine the…
A: This question asks to identify the binding site for the transcription factor TFIID in a given DNA…
Q: A 42 year old man is admitted to the hospital with the sudden onset of dyspnea with clear lungs and…
A: The patient is 42 years old and has been conceded to the hospital due to sudden onset dyspnea, or…
Q: Explain in detail the following teratogens: Listeria, the Zika virus and lead in the water supplies.…
A: Teratogens are things that can hurt a baby's development and cause issues when they are developing…
Q: Invertebrate Digestive System. Complete the table: Mode of digestion Invertebrate Protozoan…
A: The digestive frameworks of invertebrates, which are animals without a backbone, vary broadly…
Q: The provided diagram depicts a portion of the sulfur cycle. Label the diagram by selecting the words…
A: The sulfur cycle is a biogeochemical cycle that describes the movement and transformation of sulfur…
Q: You find that the population inhabit in talus (broken rocks) are greyish. Another population live in…
A: Determining whether the two pika populations belong to the same species or are two different species…
Q: what is the benefit of the telapia fish to human then need to put the author. Need like wall…
A: Consuming a range of foods, including different sorts of fish, natural products, vegetables, and…
Q: Recombination is generally initiated at double strand breaks, both during DNA repair and during…
A: Recombination, in the context of genetics and molecular biology, is a process that involves the…
Q: What variables are studied in Mortuary Archaeology? A. Human Remains B. Burials…
A: The objective of the question is to identify the variables that are studied in Mortuary Archaeology.
Q: Define the three classes of motor units and their role in muscle innervation
A: A motor unit is the basic functional unit of the muscular system. It consists of a motor neuron and…
Q: Determine which group is considered a species. all birds all red-winged blackbirds…
A: A species is defined as a group of individuals having similar types of characteristics so that they…
Q: ductor Pollicis Brevis m
A: The primary forearm flexor muscles include:1. Flexor Digitorum Superficialis: Located on the…
Q: Which of the following proteins does not belong in this group? A. Ovalbumin < BUDE Ferritin C.…
A: Proteins are a sequence of amino acids which have four levels of structure such as primary,…
Q: The reduction potential of NADH is -320 mV. To which one of the following electron carriers could…
A: Redox reactions are chemical reactions involving oxidation and reduction. In such reactions…
Step by step
Solved in 3 steps
- ECHINODERMATA ANNELIDA NEMATODA CNIDARIA Use the diagram above to Identify the animal phyla at the branch tips labeled by lowercase letters and the body plan changes indicated by the capital letters. More than one answer is possible for some letters, but you only need to write one answer. Phylum identification a b d Body plan changes A D F B.Construct a character matrix by making observations on the different features of the following group of invertebrates. On the table, write 1 if the character is present in (or exhibited by) the group; 0 if absent (or is not exhibited). Group of organisms Segmentation Coelom Jointed appendages Cephalization Tissues Radial symmetry Porifera Arthropods Cnidarians Nematodes Annelids Input the characters in the pre-made cladogramthat is provided for you. Also, write in the empty boxes the correct group of organisms to show relationships. One character and one group of organism is done for you.COMPLETE THE TABLE Basic characteristics Specialized features Phoronida Brachiopoda Echinodermata
- Please match the Arthropod subphylum or class to the description. two pairs of antennae [ Choose ] [ Choose ] Hexapoda no antennae Chelicerata Crustacea Myriapoda many tagmata and appendages [ Choose] six legs and usually wings [ Choose ] chelicerae, pedipalps, and four pairs of walking legs [ Choose ] crayfish [ Choose ] centipede [ Choose ] spider [ Choose ] > > > > > > >Fill out the accompanying table and submit on Caxpas, contrasting the key features of each class of echinoderms. Qphuraidea Holothuroidea Classs Shape of body Asteroidea Echinoidea Ambulacral groovesUse the cladogram below to answer the question that follows. Arachnata Trilobita Chelicerata Arthropoda Crustacea Mandibulata Myriapoda Insecta The closest common ancestor of Trilobita and Chelicerata is O Mandibulata O Insecta O ARthropoda O Arachnata
- Cnidaria is much more diverse than Arthropoda." Contest or defend this statement; then support your answer using evidence presented in a table that compares and contrasts diversity in feeding modes & diets, organ systems, methods of locomotion, and number of species.Give 2 examples of animals characters each thank you if possible in phylum chordataComplete the table with the correct concepts you have learned about the different characteristics of the phyla discussed. CNIDARIA MOLLUSCA ECHINODERMATA ARTHROPODA CHORDATA SYMMETRY REPRODUCTION CIRCULATORY SYSTEM DIGESTIVE SYSTEM NERVOUS SYSTEM RESPIRATORY SYSTEM
- COMPLETE THE TABLE Basic Characteristics Specialized features Hemichordata ChordataCompare the overall body plan of the prawn to that of an insect like a grasshopper. What are two similarities and two differences seen between them. Explain how the differences could be related to the two groups adaptation to their respective environments. Edit View Insert Format Tools Table 12pt Paragraph v BIU O wordsUse the cladogram to answer the following question. Cladograms are just one tool that scientists use to classify relationships between organisms. Hoglishes Sharks and Tunicales and lancelets | Lampreys Rayfinned fishes Lungfiches Salamanders lortoises Crocodilians Mammals Coelocanths Frogs ond Coeçilians loods lizards, snakes, rBirds Turtles and and luatara their relatives Endothermy Amniofic egg rue bone lungs Four Jows and paired appendages limbs Invertebrate anceslor Vertebroe Identify each statement that can be supported with evidence from the cladogram. Select ALL that applies. O A Ray-finned fish and sharks are similar in that they both have paired appendages and jaws. B. Amphibians are the first animals to have true bones. O C. Sharks were the first animals to have jaws. D. All the animals in this diagram are vertebrates. O E. Birds are more closely related to crocodiles than they are mammals. F. Lizards and birds produce amniotic eggs.