Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…
A: Photodynamic therapy (PDT) is treatment that uses drugs called photosensitizers and combine light…
Q: Agent: Escherichia coli as per urine test a. Nutritive b. chemical C, Physical D. Infectious agent…
A: Introduction Urinary tract infections in children are a marker of possible urinary tract…
Q: Can you summarize and explain for me what you want to tell in the article below? When I read it…
A: The above article describes about the Interference with Cellular Uptake, Immobilization, and…
Q: POSITIVE. GRAM- NEGATIVE. 2. Rods..... Cocci...... 3. Gelatin test positive.... Gelatin test ...Go…
A: Enterobacter cloacae is a clinically relevant Gram-negative, facultatively-anaerobic, rod-shaped…
Q: Please match the appropriate attributes for the two hormones provided (Estrogen and ADH) Hormone…
A:
Q: A blood sample is drawn in NaCitrate. The platelet count on an automated instrument is 305,000/UL.…
A: A platelet count from blood drawn into a sodium citrate tube is multiplied by 1.1 to account for the…
Q: Select the sequences relevant to eukaryotic translation AGGAGG (Shine-Dalgarno sequence) AUG start…
A: The eukaryotic translation is the process by which mRNA molecules are translated into proteins in…
Q: Assume that the length of wheat leaves is controlled by three loci, each with two alleles: L and I,…
A: A trihybrid cross is a type of cross in which three traits are involved. As per the question ,…
Q: 1 Multiple Choice A Aristotle's model of classification was used until the 1600s. Plants were…
A: Question 1 answer Aristotle was a Greek philosopher and scientist. He was the first scientist which…
Q: An allergy can best be defined as ______. A) a component of the humoral response B) an exaggerated…
A: The function of the immune system is to protect from foreign substances. Hypersensitivity is a…
Q: Describe the structure and composition of viruses. What are three reasons that they are different…
A: In nature there are many ultra microscopic particles known as viruses. A virus is small particle…
Q: In Deuterostomes, nutrient molecules (monomers) are taken in to the space between the endoderm and…
A: Option (a) is incorrect because, in Deuterostomes, nutrient molecules (monomers) are taken up into…
Q: Which is not a characteristic of mitochondria? They .. A) Have 2 membranes B) Are the site of…
A: Cells produce energy molecules at the sites of mitochondria, which are membrane-bound organelles. It…
Q: please solve these both sub-parts accurate and exact. Thank you! (a) Describe at least three…
A:
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: Snowy owls are large white birds that normally inhabit the cold northern regions of Canada.…
A: 1. As the food web shown in figure is interconnected, many species will be affected by introduction…
Q: Use the Chain of Infection to describe Legionnaire’s disease
A: Introduction Legionnaire’s disease it is type of pneumonia caused by legionella bacteria. lung…
Q: Which one of the following statements about gap junctions or electrical synapses is incorrect? A.…
A: Electrical coupling is the transfer of coordinated action potentials from one cell to the next via…
Q: Which of the following statements is false about the impacts of climate change? Choose all that…
A: Climate change is having a wide range of impacts on the environment, including increased…
Q: Explain the comercial scale of the gros michel banana
A: The commercial scale of the Gros Michel banana was very large. It was one of the most popular and…
Q: Drugs and other medecine uses the concept of signaling. Cite some drugs how they mimic natural…
A: Many drugs mimic cell signalling molecules thereby stimulating cell function and compensate for…
Q: Which of the following is NOT considered a secondary messenger? A. diacylglycerol B. inositol…
A: After a signal molecule binds to the cell receptor, a sequence of conformational changes occurs, and…
Q: Active immunization, as compared to passive, _______. A) only provides short term protection B)…
A: The development of immunity following exposure to an antigen (injected or given orally) is known as…
Q: A vaccine that employs a toxoid is based upon a ______. A) antibody B) attenuated virus C) histamine…
A: A vaccination is a pharmacological substance that enhances a person's resistance to specific…
Q: Antibodies are found: O OOOO in the blood plasma on white blood cells in fibrinogen on red blood…
A: Antibodies are the proteins molecules that are synthesized by the B cells in the blood in response…
Q: Environments with low frequency and intensity of disturbance tend to have ________ species diversity…
A: Species diversity It is described as the variety of species that exist in an environment and their…
Q: Synaptic inhibition may be produced by ACh acting through Gi-protein-coupled channels by the GBy…
A: Introduction : A variety of animals, including humans, use the organic molecule acetylcholine as a…
Q: ad this story and identify the different aspects of the scientific method by choosing the Cement…
A: In order to prove something scientifically one conducts experiment on the basis of the observations.…
Q: DNA polymerase error rates can be 10-8 to 10° per nucleotide, and mutations in the repair functions…
A: DNA polymerase is an enzyme responsible for the replication of DNA. It catalyzes the polymerization…
Q: week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to…
A: Hypertrophy is the increase in cell size. Single gene exerting its effect on more than one trait is…
Q: 2. The TP53 gene normally functions as a tumor suppressor by preventing abnormal cell growth but is…
A: In this question it is clearly mentioned about a specific gene TP53 and uncontrolled cell growth due…
Q: n fossil record, we would expect to find species with a nomocercal tail before (i.e., earlier than)…
A: The diagram is representation of phylogenetic tree which represents various groups. This…
Q: In Eukaryotes, after the ribosomes complete a synthesis, one might expect A) a new polypeptide…
A: A cell's ribosome is an organelle. It functions as a tiny protein-making machine. Extraordinary…
Q: which of the following is used to help make sure a metagenomic study has fully measured the…
A: Metagenomics is noteworthy since it may be utilized to examine assorted microorganisms found in…
Q: State and recognize the three basic nutritional needs an organism’s diet must satisfy. List the…
A: Food consists of nutrients. Nutrients is categorised into seven major groups carbohydrates,…
Q: if you replaced the hox genes that are normally expressed in a dolphin fin with the hox genes that…
A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…
Q: Which statement is true of viral replication? A) virus attaches to a specific receptor site on…
A: A virus is a non-cellular, infectious entity that is minuscule in size and can survive by surviving…
Q: If I set up a Chi square analysis and determine that I cannot reject the null hypothesis based on my…
A: When the sample sizes are large, a chi-squared test is a statistical hypothesis test used in the…
Q: the evolution of complex animals is associated with the Annelids ( Earth worm), the mollusk (clam),…
A: Introduction Protostomes , Deuterostomes ,Cnideria and Proifera are different organism categories…
Q: Choose ALL the events listed below that occur in the cytoplasm of eukaryotes. Select one or more: a.…
A: In eukaryotic cell, translation process occurs in cytoplasm. Translation is the process, that…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: When the agonist cannot bind to the active receptor in the presence of the competitive antagonist,…
Q: A population of bats becomes isolated after colonizing an island, developing a high incidence of a…
A: The population is the group of individuals belonging to the same species and able to interbreed.…
Q: Distinguish between skeletal, smooth, and cardiac muscle in terms of location and whether they have…
A: Introduction:- A tissue is defined as the group of cells that have similiar structure and functions…
Q: show me what the clade of banana and grape would look like
A: The term clade is associated with a collection of all the living and extinct members of that…
Q: Coronavirus background and origin
A: Background of coronavirus. COVID-19 is caused by a virus called SARS-CoV-2. It is a member of the…
Q: woll bevange snow done to letmin & tibong maistups-miedomibase 5. You want to treat a 15-acre field…
A: The total area for which Lexar EZ 3.7SC is to applied is 15 acres. Rate of application is 3…
Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?
A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…
Q: Explain how heterochrony may have been involved in the evolution of 1) pteropod gastropods, 2) the…
A: Solution: Explanation: Heterchrony can be defined as change to the timing or rate of development…
Q: A newly discovered gene has th 4.08 2.54 el H H 1.02 ↓ E E 1.67 E 10.8 kbp 3.94 3.66 H 10.811 E E…
A: (a) A method used frequently in labs to separate charged molecules like DNA, RNA, and proteins is…
Q: Connective tissue comes in a variety of types. Explain how variations in this tissue type help to…
A: Connective tissue is widely distributed as well as one of most abundant tissue in our body. It is…
Step by step
Solved in 2 steps
- Describe translation. What is the function of the aminoacyl-tRNA synthase?ADP ribosylation is one example of post-translational modification of an enzyme. Which statements about the process is true? ADP ribosylation will affect protein folding because of the addition of a large molecule ADP ribose can be added to the amine group of lysine or glutamine The ending of DNA around histones in the nucleus is altered by the ADP -ribosylation of the histone proteins in cancer cells ADP ribosylation requires ADP and the target protein as the substrates in the ADP ribosylation ADP ribosylation of phosphoinositol is an important step in signaling through a G protein-coupled receptor pathway.If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
- 1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…Phosphorylation is a very common post-translational modication (PTM) to regulate protein function. Which amino acids are most commonly regulated by phosphorylation? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a Leucine, arginine, serine. b Tyrosine, arginine, glutamine. C Serine, threonine, tyrosine. d Glutamine, arginine, tyrosine. e Serine, tyrosine, glutamine.
- 1. TRUE OR FALSE a) The genetic code in unambigous that means many codons can code for the same amino acids. b) There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon.Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.Describe the gene and protein defects in phenylketonuria (PKU). How are these defects connected to disease symptoms?
- which of the following amino acids can undergo post-translational acetylation? A.n B.s C.k D.m10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anDefine transcription and translation. Give 3 ways in which they are similar and 3 ways in which they are different.