Q: Question 6: As a bioengineer you are asked to develop a kit to regularly measure a protein in blo…
A: * protein measurement in blood can be measured by using the technique called bardford assay *The…
Q: Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the…
A: *Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the…
Q: Could a public health disaster such as DES occur again? Please elaborate in your answer Do you…
A: Diethylstilbestrol (DES) is a synthetic (man-made) form of oestrogen, which is a female hormone.…
Q: Transgenic animals used to produce insulin today are Saccharomyces cerevisiae Carthamus tinctorius O…
A: Introduction Transgenic animals:- These are animals in which there has been a deliberate…
Q: Name and briefly describe the 5 steps of mitosis and cytokinesis. Be specific
A: Mitosis :- Meiosis is the type of cellular division in which two daughter cells are formed and each…
Q: In your own words, explain epigenetics. What is it? What are the main epigenetic marks? What do they…
A:
Q: e difference between prophase I of meiosis and prophase of mitosis? How are they similar?
A: Introduction: The first stage of cell division in both mitosis and meiosis is known as Prophase.…
Q: Total Area (A) = 1,600,000 m2 (160 ha). w = 75 m L = 700 m Area of transect = 2wL Count all of…
A:
Q: Explain the difference between the relative and absolute refractory periods. Briefly describe the…
A: A voluntary muscle fibre contracts when threshold stimulus (optimum stimulus that could generate a…
Q: Describe two mechanisms for causing uniparental disomy.
A: Uniparental disomy occurs when two copies of a chromosome are inherited from same parent, rather…
Q: Electron transport is coupled to oxidative phosphorylation in that it creates the proton gradient…
A: The electron transport chain and oxidative phosphorylation are the last step of cellular respiration…
Q: Potatoes may have the following shapes: long, round, or oval. The cross between long and oval…
A: Due to mutations, most genes contain single or multiples versions called alleles. Based on the…
Q: Tumour associated macrophages (TAMS) represent up to 50% of cells in solid tumours. Explain how…
A: * Tumour associated Macrophages are the cells that create an immunosuppressive tumor…
Q: Which of the mechanisms efficiently and effectively organize the DNA into a usable form?…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…
Q: What statement is correct regarding the synthesis of actin monomers? a) They would be synthesized on…
A:
Q: Write a note on economic importance of algae and gymnosperms.
A: Algae have a significant economic impact. Algae have a wide range of economic applications. It is…
Q: Suppose two parents are healthy carriers of the sickle cell allele. The genotype of each parent is…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Describe the functional role of 2 to 3 micronutrients in two of the following: a) Hematopoiesis b)…
A: Micro nutrients are the nutrients which are required in trace amount in the body and they are very…
Q: Which of the following factors increase the incidence of an autosomal recessive trait in a…
A:
Q: List three similarities between the pig internal anatomy and human internal anatomy. b. List…
A: Microscopic anatomy deals with the study of structural units tiny enough to be seen only with a…
Q: Describe the arrangement of floral members in relation to their insertion on thalamus?
A: Flowers and Fruits are the reproductive parts of the plant. Flowers give rise to fruit after…
Q: In what cases would total length not be totally revealing about the length of a fish – can you think…
A: The length of the fish can be measured as follows: - Total length: - It is the length of the fish…
Q: At what Fahrenheit core body temperature will an adult lose consciousness? 87.8 82.4 85.2…
A: *mild hypothermia when core body temperature reaches about 95 F shows shivering and weakness and…
Q: What are the complications of the disease if the patient is not treated?
A: Schistosomiasis is a parasitic infection that is caused by parasites of the genus Schistosoma. These…
Q: axon pathfinding
A: This question is about axon pathfinding.
Q: Which of the following statements is/are true about collagen? a) It gives epithelial layers tensile…
A: Collagen is a most abundant protein found in the body. It has fibrous structures and serves as…
Q: Helping tags: Biology, bacterial count, dilution, serial dilution WILL UPVOTE, just pls help me…
A: A) Serial dilutions of the way of life are wanted with the purpose to get the wide variety of…
Q: A heterozygous pea plant of both traits is crossed with a recessive pea plant of both traits. What…
A:
Q: Why are sa
A:
Q: (ii) Which one of the following is non- biodegradable? A. DDT B. Vegetable peel C. Cardboard D. Bark…
A: The question is MCQ. It is asking about the non biodegradable object among the four options.
Q: Justify the following statements on the basis of external features (i) Underground parts of a plant…
A: (1) Various parts of plants are transformed into underground structures that perform a variety of…
Q: What is heterospory? Briefly comment on its significance. Give two examples.
A: Introduction In this question we will discuss about heterospory.
Q: Which of the following statements is/are true about proteins destined to be G-protein coupled…
A: G protein coupled receptors (GPCRs) are membrane proteins that allow cells to translate…
Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…
A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…
Q: 1. Explain how a "keystone species" and a "dominant species" are different.
A: Please follow step 2 for a detailed explanation.
Q: How can we increase the number of cells in (a). laboratory (from 10,000 cells to 100,000,000 cell)…
A: The increase in cell number is defined as the growth of cells. The one single cell divides to form…
Q: Characteristics Skeletal Cardiac Smooth shape of cells number of nucleus per cell location of…
A: Muscles are a type of soft tissue. Your muscles are made up of a lot of flexible fibres. Your body…
Q: If someone is showing symptoms of acute mountain sickness, you should Increase aerobic…
A: If someone, has fall in acute mountain sickness, he should move to a lower elevation as quickly and…
Q: A MET, or metabolic equivalent, is how we measure exercise based on basal metabolic rate. True…
A: Please follow step 2 for detailed explanation.
Q: Question:- In an early log-phase E. coli population, there are 1 x 103 cells/ml the generation time…
A:
Q: Biologists classify both ribosomes and spliceosomes as "ribozymes" because ... they both contain…
A: Please follow step 2 for a detailed explanation.
Q: What is the difference between prophase I of meiosis and prophase of mitosis? How are they similar?
A: Introduction Cell division is the means of reproduction in which all cells need to copy their…
Q: What is the name of DNA-strand exchange mechanism that explains recombination events during meiosis?…
A: Homologous recombination occurs in the prophase of meiosis-I. It is the change of DNA fragments…
Q: Make a conclucsion about the Seedling Growth of moggo seeds and its Responses to Stress
A: Plants are the major primary producers in our ecosystem. They can harvest the light energy from…
Q: How does hypertension affect urinary function?
A: Hypertension simply means elevation in blood pressure. It can be caused by various factors…
Q: One hundred rabbits are introduced to a new environment. Fifty rabbits are brown and 50 are white.…
A: * Genetic drift refers to random fluctuations in frequencies of alleles from generation to…
Q: What are cilia and flagella? How do these structures acquire movement? What are some examples of…
A: The above mentioned question is asking about the cytoskeletons which helps a cell to make movments.
Q: 12.What is field of cancerization? Explain part A and B of this figure. How does it explain field of…
A: Cancer is a disease in which some of the cells if the body grow uncontrollably and spread to other…
Q: Meiosis is found in which type of cells?
A: Meiosis is the process in which single cell of an individual parent divide twice time to form 4…
Q: Draw the structure of the tripeptide alanylglycylvaline and determine its name using three-letter…
A: The amino acids are the building blocks of proteins. Proteins are produced by the translation…
Step by step
Solved in 2 steps
- Heterochromatin and Euchromatin Have Which Different Histone modificationsArthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol I'm DONE being this guy's messenger boy Bod Moeba Sreters He can leave the (nucleus and do it himself for all I carel Arthur, the mRNA, was at the end of his strand at work.The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ is
- Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol. I'm DONE being this guy's messenger boy. IMI He can leave the nucleus and do it himself for all I carel IT Arthur, the mRNA, was at the end of his strand at work.Chromatin remodeling by the SWI /SNF complex requires hydrolysis of ATP. What purpose does this serve?Spliceosomes include all of the following EXCEPT enzymes catalyzing acetylation of histone proteins snRNPs RNA-annealing proteins ATP-dependent RNA-unwinding proteins
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.Clear selec All of the following pairs are well-match, except one: O Addition of Tubulin dimers occurs more quickly at the plus ends of Microtubules O Plateau phase : subunits are added and removed from MTs at equal rates. O Elongation phase: MTs grow slowly O lag phase : period of nucleation.Why is transcriptionally active chromatin ∼10 times more susceptible to cleavage by DNase I than transcriptionally silent chromatin?
- Arrange the levels of chromatin packing from most "open" to most condensed (chromosome, loops, nucleosomes, heterochromatin, 30-nm chromatin fiber)Modifications of histone tails can: O repress the transcription of some genes affect chromatin structure affect the transcription of some genes in response to the diet or environment activate the transcription of some genes all of these choices are correct The ferritin gene encodes an IRE (Iron-response element) within the 5 UTR (untranslated region) of the MRNA Considering what you know about eukaryotic translation, the IRE-BP (Iron Response Element Binding Protein) is bound to the IRE in the 5'UTR. you would expect: O That the presence of the IRE-BP would enhance translation. That the presence of the IRE-BP would have no effect. That the presence of the IRE-BP would block translation I don't remember enough about the IRE-BP or transiation to guess. 3 Assuming that the trait represented by the filled symbols in the pedigree is an inherited trait due to a single gene with alleles A and a, what mode of inheritance does the pedigree shown suggest?Histone modifications may typically decrease expression of a gene by removing histone acetylation and [Select] histone methylation, causing the chromatin to become more loosely packed.