Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript produced from this gene? Termination Start codon Stop codon sequence V 35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 1 3 4 Genomic sequence (kb) (k = kilo = 1,000) O 5000 bases 4200 bases O 3200 bases 4800 bases
Q: Which of the following may be found in both a genomic and CDNA library? intron sequence promoter…
A: A genomic library contains DNA fragments that represents the complete genome of an organism. On the…
Q: In Eukaryotes the following are areas of the gene that contain amino acid sequences information A)…
A: Amino acid sequences means the production of proteins. It is the DNA which dictates the formation of…
Q: Shown below is the genomic structure of the human B-globin gene. The numbers within the boxes…
A: Transcription is the process by which DNA act as template for the formation of mRNA . This process…
Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…
A: In the diagram shown SURF1 gene. SURF1 gene is present at 9th chromosome & produces surf…
Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…
A: Transcription The process on making mRNA from DNA which further get translated into polypeptide…
Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…
A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…
Q: Which of the following is true for both prokaryotic and eukaryotic gene expression? A. After…
A: Gene expression is a process by which the instructions present in nucleotides DNA sequence is…
Q: A eukaryotic structural gene has two introns and three exons : 5prime end exon1 intron1 exon2…
A: A gene is consisting of nucleotide sequences called as Introns and exons. Introns can be removed by…
Q: Match the following: choices: transcription factor
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Which of the following eukaryotic MRNA transcripts would NOT be able to be translated? Select ALL…
A: Translation It is defined as the process of formation of proteins by the ribosomes present in the…
Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…
A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…
Q: Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator…
A: Introduction: Gene is a unit of heredity. It contains the genetic information. It is made up of DNA.…
Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…
A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…
Q: All of the following are characteristics of eukaryotic geneexpression excepta) 5' cap is added to…
A: a) 5' cap is added to the mRNA is a characteristic of eukaryotic geneexpressionb) a poly A tail is…
Q: 5.Below is schematic of gene Z, which encodes for protein Z. the promoter is indicated by the dotted…
A: Given information In the diagram , there are Exon 1, Exon 2 and Exon 3. There are two introns 1 and…
Q: Which of the following mechanisms do prokaryotes use to produce different prdtein products from a…
A: In prokaryotes, the genes encoding proteins of related functions are transcribed under the control…
Q: Which of the following is not something commonly associated with eukaryotic MRNAS? 1. Splicing of…
A: Messenger Ribonucleic acid [m-RNA] is formed inside the cell by the process of transcription. The…
Q: The transcribed portion of a DNA sequence for a gene is shown below. Identify the MRNA sequence and…
A: The procedure of determining the order of the four nucleotide bases (adenine, thymine, cytosine, and…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: 11
A: Probably the earliest reference to age-related mental inadequacy is ascribed to Pythagoras in the 7P…
Q: Introns are intervening sequences; what are exons?
A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…
Q: A eukaryotic gene typically has all of the following features except O A5' UTR An operator O A…
A: Eukaryotic genes are regions of DNA that act as templates for the production of RNA by RNA…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…
A: A DNA sequence is transcribed to produce messenger RNA (mRNA) which is a link between DNA and…
Q: Shown below is the genomic structure of the wild-type gene for the human gene transthyretin. The…
A: Introduction: A nucleotide is an organic molecule that is the building block of DNA and RNA. They…
Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…
A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…
Q: w is the diagram of a eukaryotic gene that encodes a protein. The promoter and n start sites are…
A: Post transcriptional modification removes introns and add existing exons together in the primary RNA…
Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…
Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…
A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.
Q: Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A.…
A: ribosomal RNA one type of RNA molecule in cells that forms part of the protein-synthesizing…
Q: Think of the eukaryotic gene expression process. Which column below accurately describes which…
A: RNA polymerase is a molecular enzyme that synthesizez RNA molecule from a DNA template. RNA…
Q: You see partial sequence of a gene as follows (non template strand shown)…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…
A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…
Q: Which of the following would be present in a genome but not the transcriptome? (Select all) A)…
A: A transcriptome is the complete range of messenger RNA, or mRNA, molecules displayed by an organism.…
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…
Q: The mass of a gene is 32,400 units. The amount of introns is twice the amount of exons. What is the…
A: mass of gene = x * 300 + 2x * 300 = 32,400x = amount of exon , 2x = amount of introns 300x + 600x…
Q: Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are…
A: Transcription is the phenomenon in which one stranded RNA is synthesized from DNA strand . But RNA…
Q: Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator…
A: Transcription The transcription process involves the creation of mRNA from DNA using the enzyme RNA…
Q: Think of the eukaryotic gene expression process. Which column below accurately describes which…
A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…
Q: In a study of several families for differences in the sequence of a particular gene suspected to…
A: The mutation is the change in the nucleic acid sequence that alters the way the particular gene gets…
Q: Pre-MRNA 5' Cap Poly Codon numbers 105- 146 1-30 31-104 Introns cut out and exons spliced together…
A: The central dogma is a process that includes transcription (production of RNA from DNA) and…
Q: A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that…
A: Few important points should be kept : As we know non coding DNA is found within the most eukaryotic…
Q: For the ovalbumin gene shown in Figure 14.3, where would the 5′ untranslated region and 3′…
A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…
Q: Which of the following would probably cause the most severe damage to a gene's expression and…
A: A phenotype is expressed by a gene by the process of transcription of the gene from DNA to make an…
Q: Match the steps of transcription and translation to the location they take place within a eukaryotic…
A: Transcription is the process of making an RNA copy of a gene sequence. This copy is called mRNA. The…
Q: In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish…
A: Site-directed mutagenesis is the molecular biology technique that alters the sequence of the target…
Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…
A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: Which of the following changes to a DNA sequence would cause a frameshift mutation? OA. The…
A: Mutation are the changes that arise due to abrupt change in sequence of base pairs. It may be a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
- point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 LHere is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 1 2 3 4. Genomic sequence (kb) (k = kilo = 1,000) 2200 bases 3200 bases 2000 bases 4200 basesThe sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
- Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG
- A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?