Deuterostome animal phylogenetic tree

Q: Sofia has suffered a head injury and can no longer speak. However, after rehabiliation she recovers ...

A: MRI - magnetic resonance imaging is a medical imaging technique used in radiology to form picture of...

Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...

A: Endocrine and exocrine systems are both present in the human body. Endocrine and exocrine systems ar...

Q: Typically during the process of in vitro fertilization, several eggs are fertilized. If two of these...

A: According to Chargaff’s rule, the DNA molecule contains an equal amount of pyrimidine (thymine and c...

Q: Motor neurons innervating the digits are derived from spinal cord segment________, and then under go...

A: Answer :- Motor neurons innervating the digits are derived from spinal cord segment of muscles and g...

Q: Why is the last asymmetric carbon used to establish D/L configuration? Is this an arbitrary choice o...

A: In carbohydrates, those molecules show mirror image is known as enantiomers.  It shows absolute conf...

Q: What conditions in an environment can affect enzyme activity?

A: Introduction:- Enzymes are big protein molecules that aid in the speeding up of reactions between su...

Q: 1. Which of the following drugs is not a cardioselective beta-blocker? * A. Esmolol B. Atenolol C. P...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: How do the eggs ovulated into the abdominal cavity find their way out of the frog’s body?

A: To understand the path of the egg we need to understand that frogs lay eggs. This process usually oc...

Q: Compare the cyclic and noncyclic light-dependent reactions

A: Introduction: As the anabolic reaction that transforms solar light energy into cellular chemical ene...

Q: Carbon Copy (CC), the first cat produced from aclone, was created from an ovarian cell taken from he...

A: Cloning has been around since the late 1800s, but it wasn't until 1997 that Dolly the sheep was succ...

Q: What is the morphology of the following cells?       streptococci     diplococci     streptob...

A: Different shapes of bacteria  Different shapes of bacteria are used to categories bacteria. Differen...

Q: 1. What could be the significance of the ability of flowering plants to produce seeds? What advantag...

A: Introduction :- A seed is an ovule that has been fertilised and contains the plant embryo. It will g...

Q: Describe how temperature and pH affect enzymes.

A: Enzymes are basically proteins so they unfold and denature at high temperture.This denaturatio cause...

Q: What is the benefit of traditional cheese making for Mongolian people today?

A: Mangolias started cheese making in 1300BC Scientist found milk proteins in tooth tartar it suggest t...

Q: What is the number and types of lamprey species that are present in the Great lakes?

A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...

Q: Explain how streams can cleanse themselves andhow these cleansing processes can be overwhelmed.What ...

A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...

Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...

A: The study of what makes a certain action in a specific scenario the proper thing to do is known as e...

Q: АCTMTY 10.6.1 Label the diagram and explain the salient feature that is happening in each item. For ...

A: Introduction: Electron Transport Chain is a series of compounds where it makes use of electrons from...

Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT...

A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of...

Q: 4. If several pea plants with the genotype TTYY are crossed with pea plants with the genotype Tlyy, ...

A: As per bartleby guidelines we are only suppose to answer one question kindly post the other one sepa...

Q: How was smallpox eliminated? Natural immunity? Vacination? Etc. Appreciate that viruses are obligate...

A: Microbes are organisms that are too small to detect without a microscope, such as bacteria, archaea,...

Q: Which of the following would not be an example of a quantitative trait? O All of these are quantitat...

A: Introduction  The classical Mendelian traits are generally considered to be Qualitative in nature i....

Q: Basic Alternation of Generations. What are the structures in plant life cycle that are haploid?

A: Alternation of generations means that the plant's life cycles alternate between diploid (sporophyte)...

Q: What is the justification for considering gap junctions and plasmodesmata to be functionally similar...

A: Introduction: Plasmodesmata are living cytoplasmic connections between neighboring plant cells which...

Q: Discuss the Steps for Equipment Selection as well as Equipment Utilization in a 1000 bedded hospital

A: Defining the need Surveying the standard guidelines. Search for possible product providers Inspectio...

Q: Which of the following exhibits Invoked Organization? * i. Regal Angelfish ii. Orb web spiders iii. ...

A: Although each living and non-living entity in the world appears to follow its unique pattern, a clos...

Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...

A: Genetics is the discipline of science concerned with the study of genes and their transmission from ...

Q: Explain periplasms and their importance

A: Introduction :- In Gram-negative bacteria, the periplasm is the gap between the inner and outer memb...

Q: most hydrophobic molecule listed below would be

A: Ans 1.  C2H6   Ans.2. Dehydration reactions assemble polymers, and hydrolysis reactions break down p...

Q: Can you help me identify the pointed structure thanks

A: There are various kinds of glial cells present in central (CNS) and peripheral nervous system (PNS)....

Q: Distrubuting areteries possesses more smooth muscle in tunica externa? yes or no

A: Arteries are constantly under stress. The aorta and pulmonary arteries, which are closest to the hea...

Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...

A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...

Q: Discuss the changes  and what is happening in the adolescent brain- explain thoroughly (Write in par...

A:  As a result, the vast majority of adolescents are included in the Convention on the Rights of the C...

Q: The electrochemical gradient across the plasma membrane Group of answer choices is caused by more s...

A:     sodium concentration is more in outside the cell than the inside of the cell.  Sodium potassium ...

Q: ng potential, the following statements is like not true about the figure/illustration below? * DRY D...

A: Solution : correct option is C

Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...

A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...

Q: Catalase combines two hydrogen peroxide molecules(H2O2 + H2O2) to make two molecules of water. A gas...

A:

Q: Help explain this LAPTM5 and LAPTM5 restrict HIV-1 infectivity

A: Answer 

Q: 3.22 A 72-year-old man presented with confusion, vomiting and seizures. A CT scan is shown, which sh...

A: Answer is B. Prostate   Cerebral metastases Metastases to the brain are the most feared complication...

Q: Which type of evidence for evolution is most accurate in determining evolutionary relationships–morp...

A: In biology, evolution refers to changes in an organism' features over numerous generations as a resu...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: How does a healthy microbiome impact each individual?

A: The microorganisms’ community that can be found inside or on the human body come under the category ...

Q: TRUE OR FALSE

A: Puberty is the time when a boy or girl becomes sexually mature. It occurs between ages 10 and 14 for...

Q: What are three actions you would take to reduce theglobal threats to human health and life from each...

A: Pathogenicity represents a specialization in a certain microorganism to replicate and damage host ce...

Q: Which parameter from the software must you adjust in order to permit gene flow? Starting frequency ...

A: Definition: Gene flow is the movement of gene from one organisms to another one. It can be in a hori...

Q: PROBLEM SOLVING: In the human pedigree below, the filled symbols represent the affected individuals....

A: Genotype  Genotype is the collection of all gene inside an organism.

Q: Explain why living things metabolize.

A: Answer : metabolism is the process of the chemical reactions which occurs in the body which changes ...

Q: 14) Which of the following correctly ranks the steps in the secretory pathway? 1 Active PKA subunits...

A: This is the hormone induced activation of Adenylyl cyclase and PKA in a secretory pathway. Let's tak...

Q: When you flush your toilet, where does the wastewater go? Trace the actual flow of this water in you...

A: The wastewater treatment plant is an important part of the community. It helps ensure that the waste...

Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...

A: dominant stands for a characteristic that is more likely to be expressed in the offspring than the r...

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.