D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure ↑ 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription
Q: Using Bradford Assay, plot the standard curve and find the unknowns. Protein Concentration A595 of…
A: Standard curve A set of standards are put up in the Bradford assay procedure from protein sources…
Q: The ____ is most like an endoskeleton. Choose one: A.wooden frame of a house B.chair's covering…
A: Introduction Endoskeleton:- It is an internal skeleton or supporting framework in an animal, Some…
Q: The key features of recent phase of human evolution.
A: Introduction:- The five stages of human evolution are: Dryopithecus Ramapithecus Australopithecus…
Q: Mang Noel and Efren are very close friends. They live in a province which main source of income…
A: Hi dear, here's your answer what you want.can you please give me an upvote for this answer. Rice…
Q: What is the Krebs cycle
A: Cellular respiration is a metabolic pathway that breaks down glucose and from this breakdown of the…
Q: Table or Energy Carriers Produced in Glycolysis, the Transition Step, and the Krebs Cycle of FADH,…
A: These are the plastic strip consists of chemicals. It changes colour when dipped in urine.
Q: 3. Each type of blood cell has a different job. Explain the job that each does. Red blood cells:…
A: Red blood cells : These are the cells that carry the inhaled oxygen from our lungs to the rest of…
Q: Describe the structural features of the human immunodeficiency virus and the host cell membrane that…
A: Structural features of HIV virus Human immunodeficiency virus shape :spherical. (cone-shaped)…
Q: To describe: The way in which origin of photosynthesis affects subsequent evolution of life on…
A: Prokaryotes were the first cells to form in the Earth's ocean that did not contain genetic material…
Q: how are microorganisms are involved in the production of lagers? include the process of…
A: Introduction Lager is a kind of beer that has been blended and molded at low temperatures. Lagers…
Q: 1- Depending on the enzymatic method in DNA isolation, What is the defending mechanism of our eyes…
A: Introduction Physical and chemical barriers that are always ready and prepared to guard the body…
Q: What are the THREE tissues of haematopoiesis and when are they used?
A: Hematopoiesis, or the production of blood cell components, happens throughout embryonic development…
Q: Which of these epigenetic changes could lead to reduced transcription of a particular gene? Please…
A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…
Q: Summarize the major functions of the respiratory system
A: The respiratory system involves the complex network of tissues and organs that helps in gas exchange…
Q: The way in which origin of photosynthesis affects subsequent evolution of life on earth.
A: Introduction The origin and subsequent evolution of photosynthesis, the process by which light…
Q: Random mutation in the DNA sequence of a coding gene can lead to different genetic outcomes. Provide…
A: Mutation Mutation is the change in the sequence of DNA or gene.
Q: A tall, purple-flowered pea plant (AaBb) is allowed to self-pollinate. Determine the genotypic and…
A: The genetic well defines that they are been stated as the constitution of an organism is referred to…
Q: 5) There are several coronaviruses in the database, why is the SARS-CoV-2 so dangerous?
A: WHO declared the COVID-19 eruption, caused by severe acute metabolic process syndrome coronavirus-2…
Q: Explain what functions spectrins impart on red blood cells?
A: A large, cytoskeletal, and heterodimeric protein is called spectrin. It consists of α and β…
Q: To describe: The functions related to genetic differences between Homo sapiens and hominin…
A: The species appears and disappears in a consistent and relentless manner. Mass extinction events…
Q: Complete the tabulation that describes the various processes employed by living things to generate…
A: Introduction Cellular respiration:- It is the process of breakdown of food in the cell with the…
Q: Earthworms have a(n) ____. Choose one: A.segmental skeleton B.endoskeleton C.exoskeleton…
A: Earthworm belongs to phylum Annelida of kingdom Animalia.They are triploblastic(have three germ…
Q: Describe the types of muscle-bone attachments?
A:
Q: Describe the causes of the spread of suburbs, and outlinethe environmental, social, and economic…
A: The fast growth of the geographic extent of cities and towns, also known as sprawl or suburban…
Q: substrate substrate kaybed enzyme enzyme enzyme-substrate complex 1. What is a catalyst? 2. What…
A: All enzymes are catalysts. Catalyst speef up the reaction. Disclaimer - Since you have posted a…
Q: The body plan of an annelid displays meaning that the body is divided into a series of repeated…
A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…
Q: A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several…
A: Operon is a segment of DNA that carry many genes along with regulatory elements. Lac operon contains…
Q: What was the molecular evidence that demonstrated the lineage relationship between granulocytes and…
A: A type of immune cell that has granules (small particles) with enzymes that are released during…
Q: Please answer fast Give ans for each statement 1.A protein linked to a disease state is being…
A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…
Q: n organ is defined as ____. Choose one: A.two or more tissues organized and capable of carrying out…
A: The levels of organizations in the body vary from the cellular level to complex organ systems. The…
Q: Identtidy which among the list represents the hierarchy of muscle structure from the largest unit to…
A: Muscles are connected to bones by means of tendons. They contract to produce movement and thus help…
Q: 1. The megaphyll type of leaves in ferns that both function as a photosynthetic and reproductive…
A: 1. Megaphyll are considered to be the large sized leaf which are found in seed plants and ferns. On…
Q: Bacterial biofilm was defined for the first time in 1978 as a structured community of microorganisms…
A: Pseudomonas aeruginosa biofilms are able to cause number of chronic diseases and infections in human…
Q: 1 2 1 2 3 4 모요 3 4 5 6 7
A: Inheritance pattern is a type of pattern which evaluates how transmission of traits takes place . It…
Q: A hypothetical brown frog with black spots (genotype BbSs) is test crossed with a green, unspotted…
A: A test cross is done to identify the genotype of an organism. In this cross, the organism is crossed…
Q: The endosymbiont hypothesis for the origin of chloroplast and mitochondria.
A: Mitochondria and Chloroplast Mitochondrial (the powerhouse of the cell) is found in plants and…
Q: Trace elements are required by organisms in only minute quantities (less than 0.01% of mass). Which…
A: The components, kind of molecule, and type of cell are all factors to consider when determining the…
Q: Cytokinesis in Plant Cells • A plant cell has a rigid cell wall covering its cell membrane ( plasma…
A: Cell division takes place in two phases. Karyokinesis is the division of DNA and nucleus.…
Q: 12. THE HUMAN HEART: Match the labels to the parts of the heart below. WRITE THE LETTER ONLY. Key…
A: Human heart is a muscular organ with four chambers. It is about the size of a clenched fist.
Q: To describe: The information that has been revealed by present methods about the successors of…
A: Dinosaurs thrived for more than 100 million years, and there is no certainty behind dinosaur…
Q: Fill in the gaps in the following sentences using the words in the box below. i) Enzymes are…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: Complete the tabulation that describes the various processes employed by living things to generate…
A: Introduction Respiration:- It is the chemical process by which organic compounds release energy, It…
Q: how are microorganisms are involved in the production of lagers? include the process of…
A: Lager beer, light-coloured, highly carbonated type of beer. The term lager is used to denote beer…
Q: (a) Berdasarkan Rajah 7.2, Based on Diagram 7.2, (i) apakah yang berlaku kepada populasí alga di…
A: The available nutrients in an aquatic ecosystem is the determining factor of the the structure and…
Q: substrate active site با substrate enzyme enzyme enzyme-substrate complex 1. What is a catalyst? 2.…
A: Typically, a substrate is the chemical species detected in a chemical reaction that reacts with a…
Q: Usually, the mutant alleles studied in Drosophila experiments are recessive because: A. they are…
A: An allele is called mutant when it differs from the alleles present in normal / wild type…
Q: Human Histology *Refer to the attached photo and answer this question: What is the function of the…
A: Human Histology is a very important part of biology. It is used to investigate various types of…
Q: What would the answers to each of the questions be?
A: Diabetes insipidus occurs when the body can't regulate how it handles fluids.
Q: how are microorganisms are involved in the production of lagers?
A: Lager is a kind of beer that has been blended and molded at low temperatures. Lagers can be pale,…
Q: How dose the use of lab and shoulder restraints influence the patterns of injury described here? (Up…
A: Restraint is defined as "the denial or restriction of liberty or freedom of action or movement," and…
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.