Q: Make a dichotomous key about: Weeping fig, Fukien tea tree, Poisonhub, Dragon Tree, and Balsam…
A: A dichotomous key is a valuable tool for identifying things that are unfamiliar to the observer,…
Q: What biological molecules can you measure a concentration of using a spectrophotometer?
A: Introduction: A scientific method called spectrophotometry is used to quantify the amount of light…
Q: Process when an offspring develops within the mother's womb
A: Introduction The joining of a human egg and sperm takes place in the fallopian tube's ampulla and…
Q: Which tenet of the cell theory is supported by the concepts of mitosis and meiosis? O Cells come…
A: In biology, cell theory is a scientific theory which was first formulated during mid-nineteenth…
Q: The five cells shown in figures a-e below are all from the same individual. Which of these cells…
A: Option a is from Meiosis I This denotes the separation of homologous chromosomes. Assuming (2n) to…
Q: Hypothetically speaking, what will be the form of chromosomes if it will condense after S phase? O…
A: Cell division is a phenomenon in which parent cell splits to form new cell . It comprises of:- I )…
Q: List down 5 other instruments and equipment that are used to in ecology studies and discuss where it…
A: In ecological studies, two most important factors include biotic factors and abiotic factors. In a…
Q: Compare the two types of cell division in terms of the kinds of cells where they occur, Number of…
A: The fundamental and active biological process by which a parent cell after replication of its…
Q: Why or why not can solar induced fluorescence be used to infer net photosynthesis?
A: Introduction :- Photosynthesis is the process by which plants generate their own energy from the…
Q: Which of the following does not characterize the different factors that affects the rate of…
A: Diffusion is a physical process that refers to the net movement of molecules from a region of high…
Q: Which of the following statements is an accurate representation of the five unifying themes of…
A: The living organisms shows some characteristics that includes- metabolism, homeostasis, response,…
Q: Which animal have endolymphatic ducts? a. Cat b. Frog c. Chicken d. Turtle e. None
A: Introduction The vestibular aqueduct is located in the bony labyrinth of the petrous temporal bone,…
Q: The following flows through the connective tissue surrounding the blood vessels: O a. Intracellular…
A: Introduction Connective tissue is a group of tissues found throughout the body that help to keep the…
Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…
A: The cell division in eukaryotes follow a cyclical events in which the the cell grow in size,…
Q: There are large endocrinocytes in the wall of the follicles and in the interfollicular layers of the…
A: A important hormone gland, the thyroid gland is important for the growth, development, and…
Q: armer plans to plant varieties X a randomization of the plots.
A: Randomization is most useful in situations in which the experimental material is heterogenous and…
Q: Two alternative 3' cleavage sites will result in: A. genes of different length. B. pre-mRNA…
A: Introduction Living cells and organisms reproduce and transmit the characters from generation to…
Q: 4) Do you have a dimple in your chin? Partner A: Yes or No Partner B: Yes or No Having no dimples in…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: . Please answer
A: Mitosis is a type of cell division that results in two daughter cells each having the same number…
Q: Which of the following receptor signaling pathways require that the growth factor/activator…
A: Signaling molecules also known as ligands are produced by signaling cells and the subsequent binding…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: Discuss the relationship between viruses and endocytosis. Compare bacteriophage AND animal viruses…
A: Endocytosis is the engulfment of any molecule inside the cell membrane of the host. Receptor…
Q: 3. The pedigree below was obtained for a rare kidney disease. a) Deduce the inheritance of this…
A: Introduction The study of a specific trait that is passed down from one generation to the next is…
Q: Describe how vesicles are cycled in the presynaptic terminal. Use a diagram if necessary
A: The science of cell structure and function is known as cell biology, and it is based on the idea…
Q: Please answer
A: Prophase is the first stage of cell division, before metaphase, during which the chromosomes become…
Q: Create a diagram or model on cytoplasm.
A: Each cell is filled with a viscous fluid called the cytoplasm, which is encased in the cell…
Q: Select all of the characteristics shared by Penicillium chrysogenum and Euplotes vannus. A) Both…
A: Eukaryotic organisms are those that have sub-cellular membrane-enclosed organelles that are specific…
Q: Which of the following are examples of post- translational modification (PTM)? (select two answers)…
A: Introduction :- The chemical alterations that take place after a protein is generated are referred…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…
A: Introduction :- In the eukaryotic cell cycle, a checkpoint is a time where the cell evaluates both…
Q: Instructions: Species name 1: Sample illustration: Taxonomic account (domain to species): At least…
A: Introduction R. H. Whittaker’s classification system divides organisms into five major groups. These…
Q: How does the fact that our brains evolved relate to the role of exercise on brain function? Choose…
A: Evolution of brain is a complex phenomena. During the course of evolution, natural selection…
Q: Give two strategies that our agricultural community can use to climate-smartly agriculture and adapt…
A: Introduction:- Since the beginning of agriculture, farmers have had to adjust to the conditions…
Q: In another experiment using Quikchange to amplify the pQE.1-CRYGD plasmid containing our mutation,…
A: Introduction A common laboratory method for producing several copies of a specific DNA region is the…
Q: Ion Kt + Na CI™ K Na+ CI Kt Nat CI™ Kt + Na CI Relative Permeability 10 1 10 1 10 Concentration (mm)…
A: Introduction The resting membrane potential, often known as the resting potential, is a voltage…
Q: How does plant cytokinesis differ from animal cytokinesis? Opposing forces distribute the cell…
A: Cytokinesis is the division of cytoplasm where a parent cell divides into two daughter cells, each…
Q: key step happens during anaphase? lication of chromosomal DNA in the nucleus ndensation of…
A: Anaphase is derived from Greek word meaning ana- 'back or backward', and phases meaning…
Q: In a cross between BbTtSS and BBttSs, what is the probability of offspring being BBTtSS?
A: Introduction : A graphical representation of the possible genotypes of an individual that results…
Q: Match the labels with their corresponding letters in the image below. B A C D F
A: Introduction The structural, and functional components of all living organisms are cells. A cell is…
Q: Hypothetically speaking, what will be the form of chromosomes if it will condense after S phase? O…
A: Most genes on the X chromosome are distinct from those on the Y chromosome. As a result, men and…
Q: When do chromosomes condense during the cell cycle? OM phase OG2 phase OG1 phase OS phase
A: Introduction: A cell's growth and division are accompanied by a sequence of processes known as a…
Q: Which of the following would inhibit the activity of TGF-Beta receptor? multiple answers A.…
A: Signaling molecules in the body allow cells to react to altering external surroundings. Cells…
Q: Which of the following marks an important event during telophase? O nuclear envelope starts to…
A: Mitosis is a type of cell division that divides a cell into two daughter cells without changing the…
Q: Which of the following marks an important event during telophase? movement of chromosomes at the…
A: Mitosis is a cell division process in which the chromosomes replicate and are evenly distributed…
Q: How does mitosis result in daughter cells containing identical number and same DNA with its parent…
A: MITOSIS It is also called the indirect / somatic or equational cell division. Daughter cells have…
Q: Which will happen during anaphase? O Sister chromatids align at the metaphase plate Chromosomes…
A: The cell cycle It is defined as the all those changes that occur during the cell growth and cell…
Q: What is the difference between the metaphase chromosome and telophase chromosome? Metaphase…
A: There are two types of cell division: mitosis and meiosis. Meiosis produces four sex cells, whereas…
Q: A healthy couple had their first child affected by cystic fibrosis. Their next three sons were not…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homozygous…
Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…
A: The biological process of creating two identical copies of DNA from a single original DNA molecule…
Q: What are some special biology terms that people don't know much about? Give some examples.
A: A study of life is called biology. Biologists generally research the composition, function,…
Q: Increases in the incidence of a disease may be due to a(n): O Increase in the infectivity of an…
A: Ans: Increase in the incidence of disease can be stated as the occurs of new cases in the population…
Define “COVID-19” using the rules you have learned. You may also choose to use the outline below to help you in writing a good definition paragraph. Write your answer on a separate sheet of paper.
Topic sentence: COVID-19 is _____________________
- First (supporting Point#1) + (Fact, reason, or detail)
- In addition (supporting point #2) + (Fact, reason, example or detail)
- Finally, (supporting Point #3 + (Fact, reason, example or detail)
- Conclusion: In the end, COVID 19 is _______________
Step by step
Solved in 2 steps with 2 images
- provide handwritten solutionGive explanation Solution (don't give Handwritten)Please search on-line and find a manufacturer's data sheet for a transducer or sensor used in a medical device. Highlight the characteristics (properties) of the sensor or transducer and post your search results. You must provide references for your work (Hint: Your search result might have one or some of the following: Sensitivity, Accuracy, Hysteresis, Frequency response, Reproducibility, and Resolution).
- Give detailed Solution (don't give Handwritten answerThink of a possible safety or ethical issue related to genetic engineering and discuss briefly (in 3-5 sentences) why this is a valid concern. Write your answer on the space provided below.“A biomedical device is intended for use in the diagnosis of disease, or in the cure, mitigation, treatment, or prevention of disease, in man or other animals, or intended to affect the structure or any function of the body." List one device of each type (mentioned in red) in a table that contain two rows "Type, Example".
- Choose a syndrome or disorder caused by a mutation and research about it. Summarize the information in a 5-8 sentence paragraph, highlighting the cause, the type and the effects of this mutation, and your reflection about the research.Use the image to fill out the missing informationShare your abstract or a 1-2 paragraph description of your evidence-based paper. Share your dissemination ideas. In this section, you will want to have at least two references. One reference needs to be from the course readings (ie the White or Melnyk texts) and at least one needs to be from your research paper. For discussion, please give each other feedback on your work. This allows each student to receive input on their final paper prior to its due date. In the discussion, you may not have any references. Please write or paste your posting in the discussion box instead of attaching it in a document. Thanks!
- The disease I have chosen to research is Parkinson's disease. find three (3) citations that could be used for this topic. Annotate each of these citations with a separate 5-sentence paragraph, including the following information: Description of the source and author: Are they reliable and valid? [1 sentence] Description of findings that may be important to your project. [2–3 sentences] Include the reason why you chose the source. How will it support your project? [1 sentence] The first 3 were already done I need another 3 citations please!The disease I have chosen to research is Parkinson's disease. find three (3) citations that could be used for this topic. Annotate each of these citations with a separate 5-sentence paragraph, including the following information: Description of the source and author: Are they reliable and valid? [1 sentence] Description of findings that may be important to your project. [2–3 sentences] Include the reason why you chose the source. How will it support your project? [1 sentence]As Mary glanced through the mathematics test paper, she was elated that she had studied all the key terms. The first term in a list to be defined was: Translation. Mary was not worried as she had read the meaning over and over again. She quickly wrote: Translation is defined as the process of translating a foreign language to another native language to conveymeaning. Having completed the first part of the item, Mary turned to the second part of the same test item. She noticed that it required her to justify the preferred meaning for one of the list of terms. Mary was taken aback at the nature of the item. She found herself wondering if a preferred meaning should be the same as a preferred definition. During her primary schooldays, the meaning of a word was the same as its definition. Had this changed? Although she was unsure, she decided to try by discussing her experiences that influenced the personal significance of the term, translation. She knew she would have to check her…