Construct the data matrixFrom the DNA sequencedata from the 5 taxa.(Hint: there are threevariable nucleotidesites, which are thecharacters)Map all threecharacters onto bothmypotheses using twoColors (same as inActivity 6).3position1111111 2 3 4 5 6 7 8 9 0 1 2 3 4 5ATTGCGGCCTGTATGTaxon ATaxon B ATGGCGGGCTGTAAGTaxon C ATTGCGGGCTGTATGTaxon D ATTGCGGGCTGTAAGTaxon EATGGCGGCCTGTATG1Determine thetreelength of bothhypotheses and fill in3the treelength and Justify Textminimum number ofchanges in the table onthe lower right. Thencompute the CI for bothhypotheses and put acheckmark or X toindicate which one isthe most parsimoniousand which one is themost accurate.4Character/statesTaxon AUse the most accurate phylogenyto infer the origin of the newfungal pathogenTaxon BHypothesisTreelengthMinimumCIMost parsimoniousMost accurateTaxon CTaxon D1taxontaxon Ataxon Btaxon Ctaxon Dtaxon ETaxon EMinimum2originFlorida (new)MexicoChinaIndiaBrazil2Save the completed worksheetas a pdf and upload on BlackboardHypothesis 1BAC D Echaracter 1Hypothesis 1BAC D EHypothesis 2BD CA Eបុប្ផcharacter 2Hypothesis 2BD CA EHypothesis 1Hypothesis 2BAC DE BD CA E!!character 3Most likely origin of4 new fungal pathogen:MexicoChinaIndiaBrazil

Name: Construct the data matrixFrom the DNA sequencedata from the 5 taxa.(H
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Construct the data matrixFrom the DNA sequencedata from the 5 taxa.(Hint: there are threevariable nucleotidesites, which are thecharacters)Map all threecharacters onto bothmypotheses using twoColors (same as inActivity 6).3position1111111 2 3 4 5 6

We are given Different Taxon with the nucleotide sequences. We need to prepare a matrix and find out…

Science

Biology

Construct the data matrix rom the DNA sequence lata from the 5 taxa. Hint: there are three variable nucleotide sites, which are the characters) position 111111 123456789012345 Taxon A ATTGCGGCCTGTATG Taxon B ATGGCGGGCTGTAAG Taxon C ATTGCGGGCTGTATG Taxon D ATTGCGGGCTGTAAG Taxon E ATGGCGGCCTGTATG taxon taxon A taxon B taxon C taxon D taxon E origin Florida C Mexico China India Brazil

Construct the data matrix rom the DNA sequence lata from the 5 taxa. Hint: there are three variable nucleotide sites, which are the characters) position 111111 123456789012345 Taxon A ATTGCGGCCTGTATG Taxon B ATGGCGGGCTGTAAG Taxon C ATTGCGGGCTGTATG Taxon D ATTGCGGGCTGTAAG Taxon E ATGGCGGCCTGTATG taxon taxon A taxon B taxon C taxon D taxon E origin Florida C Mexico China India Brazil

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?
For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTAT
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…