Biological Macromolecules Identifying molecules that could be in a cell membrane te for advanced students: none of these molecules are actually found in cell membranes. Your goal is to use the principles of biochemistry to dec ey could be, if for example they were synthesized and studied as drug candidates. 0 OH H₂N molecule Could be in a membrane? Membrane would be to the..? X CH3 O yes -left right- O no O yes - left right- по Ο O Oyes -left right→ О по Oyes -left right- Ono G
Q: Why is it that the carboxylate "ions" actually partake in the citric acid cycle ratherthan the…
A: The regeneration of oxaloacetate from citrate is called the citric acid cycle. It occurs in the…
Q: Question 1: The standard reduction potential for the the cytochrome c Fe3+/Fe2+ redox couple and for…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Genetics 8 Q1
A: The question is asking to identify the type of chromosome rearrangement that involves two…
Q: Draw the structures of Allura Red and the reduced products formed when it had reacted with NADH
A: Allura red is synthetic food coloring, it is a red azo dye that is frequently used in various food…
Q: The structures of the amino acids leucine and isoleucine are shown: H N-C-C CH₂ CH HỌC CH, Leucine H…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: Problem 5
A: The objective of this question is to determine the rarest class of offspring from a genetic cross…
Q: What is the relationship between the following monosaccharides (enantiomers, diastereomers, or…
A: Enantiomers are stereoisomers that are mirror images of each other. The D and L forms of a sugar are…
Q: Explain the underlying biomechanical constructs of spring, change of direction, and agility…
A: Spring-like biomechanical constructs refer to the ability of muscles and tendons to store and…
Q: Sickling occurs in deoxyhemoglobin S but not in oxyhemoglobin S. Oxyhemoglobin has a small,…
A: Sickling is the process where the haemoglobin protein inside the RBC cell clumps together this…
Q: How many TCA cycles required to fully oxidize 1 molecule Acetyl-CoA. Support your answer with…
A: There are two oxidizable carbons in acetyl-CoA; the methyl carbon (CH3-) and the carbonyl carbon…
Q: Genetics Question 9
A: The objective of the question is to identify the event that occurs last during meiosis and the…
Q: Use the appropriate equation to calculate the free energy change for the movement of Nat into the…
A: The Nernst equation, named after Walther Nernst, is a powerful tool in electrochemistry that relates…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Н HCG 6 N 5 7…
A: Deoxyribonucleic acid (DNA) is a molecule that is present in all known living things as well as many…
Q: Since two 19S regulatory subunits and a 20S catalytic unit constitute the 26S proteasome, why is the…
A: A peptide is a short chain of amino acid residues linked together via peptide bonds. A folded…
Q: 11. Quantitative Relationships between Rate Constants to Calculate K, Kinetic Efficiency (kcat/Km)…
A: Kinetic parameters are Km and Vmax. They are used to determine the efficiency of an enzyme. Km is…
Q: Consider the following structure. CO₂CH2CH3 CO₂CH2CH3 This substance could be produced by the…
A: True.As it was a Diels-Alder Reaction so the given structure will be produced.Explanation:It is a…
Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…
A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…
Q: Describe how the shape and size of nucleotides are important in the structure of double-stranded…
A: Nucleotides that make up DNA are composed of 3 components; a deoxy ribose sugar, a phosphate and a…
Q: In an a helix, how does bonding occur between the amino acids in the polypeptide chain? Match the…
A: An amino acid is a biomolecule made up of a hydrogen atom, an amino group, a carboxyl group and a…
Q: The following amino acid is dissolved in solution at pH 7.4. HC H + CH CH₂ H H+ HC a. Which amino…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation:pH =…
Q: The peptide below 요 H3N-CH- -NH- -CH- NH–CH=C -NH-CH-C NH–CH- C-OH CH3 CH2 CH2 CH2 CH HO-CH, CH2 C…
A: Peptides are produced from amino acids. The pH of the medium and the amino acid sequence determine a…
Q: Create a fishbone diagram for the process of creating an acceptable calibration curve for the…
A: In order to prepare a calibration curve for the spectroscopic determination of rHCA (recombinant…
Q: 16. A quantitative study of the interaction of a protein with its ligand yielded the following…
A: I cannot plot the graph as that would be doing your homework.Determine KD:From the graph, read the…
Q: Blood plasma contains a total carbonate pool (essentially HCO3 and CO₂(d)) of 2.5 x 10-2 M. What…
A: In order to solve this problem, first we need to calculate the initial concentrations of bicarbonate…
Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…
A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…
Q: Create a concept map to demonstrate the relationships between carbohydrate, protein and lipid…
A: Catabolism is the breakdown of large molecules into smaller ones. This is often undertaken to…
Q: The conversion of pyruvate into acetyl CoA consists of three steps. Identify these three steps and…
A: The pyruvate dehydrogenase complex (PDHC) is an enzyme complex composed of 3 enzymes.Pyruvate…
Q: Identify which one among the 6 carbohydrates; Glucose, fructose, maltose, lactose, sucrose or starch…
A: CarbohydratesMolisch TestBenedict's TestSeliwanoff's testlodine testBial's testMucic acid…
Q: Draw the chemical structure for a phosphatidylethanolamine which contains trans, trans, cis-Δ10, Δ15…
A: I can describe the structure for you. The phosphatidylethanolamine molecule with trans, trans,…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…
Q: Which of the following is(are) formed upon addition of 1 mol of Br2 to 1,3-cyclohexane? Br Br 1, 2…
A: for given chemical reaction,Option 4 is correct.(only 2 and 4)Explanation:Step 1The role of reagents…
Q: When a leaf on an oak tree absorbs 15,440 photons, how many glyceraldehyde-3-phosphate molecules can…
A: Calvin cycle is also known as the C3 cycle. It is the cycle of chemical reactions where the carbon…
Q: Molecule A held promise as a treatment for rheumatoid arthritis except that it remained in the body…
A: Many factors determine the duration of time a drug stays in the body. The drug being hydrophobic…
Q: Which of the following enzymes requires a cofactor to carry out catalysis? A- GI lipase B- HIV…
A: Enzymes are primarily proteins. Most enzymes are only functional when they are associated with a…
Q: Given, isas ri Glucose + Pi→ Glucose-6-P ATP + H₂O → ADP + Pi Determine K 'eq for a coupled reaction…
A: Consider a reaction ; A B. Its biochemical equilibrium constant (K'eq 1) will be;Now consider a…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: Which four statements about amino acids are true? The form of glycine used by the human body is…
A: Amino acids are organic compounds that serve as the building blocks of proteins. They have a…
Q: D. Explain why a protein (polypeptide chain) will assume a different 3-dimensional structure in: (1)…
A: The three-dimensional structure of a protein, also known as its native conformation, is critical for…
Q: s) In two experiments carried out in a research lab, an enzyme reaction is run with and without an…
A: Enzymes are proteins that catalyze biochemical reactions. They contain an active site where the…
Q: Assuming I got 1, 2, and 3 right can you please help with 4?
A: The objective of this question is to determine which generation the phenotype of the F2…
Q: 10. A new protein of unknown structure has been purified. Gel filtration chromatography reveals that…
A: From the given data, we can deduce the following about the protein's tertiary and quaternary…
Q: Genetics Question 14
A: The question is asking whether sister chromatids are always identical during the process of meiosis.…
Q: You are studying how your Lys-Val-Thr tripep de interacts with another pep de, which places an Asp…
A: Eventhough all ionizable groups have their characteristic pKa value, the pKa value of an ionizable…
Q: The peptide below is placed into a buffer with a pH = 1.73 H3N-CH- CH2 NH—CH—C H3C-CH NH—CH—C NH—CH-…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: Which of the following is true about a mixed type inhibition? a. None of these is true b. A…
A: The enzyme kinetics, inhibition in particular, is vital to understanding and purposefully managing…
Q: ou are studying the tripep de Lys-Val-Thr. a) Could you use the absorbance at 280 nm to determine…
A: Protein concentration can be determined using spectrophotoscopy. Here, the absorbance of a protein…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part g: What chemical and structural characters are…
A: Part g: There are several chemical and structural similarities between the amino acids Ile…
Q: 1. Substrate Enzyme 1 2 3 Look at the above diagram and understand what is being shown. Explain AND…
A: Enzymes are proteins that catalyze biochemical reactions. The substrate binds to the enzyme's active…
Q: Tube # 2 3 4 6 5. THE EFFECT OF TEMPERATURE Temp. Abs. 0°C N/A 0°C 25°C 25°C 37°C 37°C 70°C 70°C 10…
A: Changes in temperature can affect the enzyme in different ways. When the temperature of the system…
Q: In a uni uni enzyme reaction, what is the substrate concentration relative to Km when an enzyme…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Step by step
Solved in 4 steps with 1 images
- esc Decide whether each molecule in the table below could be found embedded in the outer surface of a cell membrane. For each molecule that could, decide whether the outside of the cell would lie to the right or left of the molecule as drawn. Note for advanced students: none of these molecules are actually found in cell membranes. Your goal is to use the principles of biochemistry to decide whether they could be, if for example they were synthesized and studied as drug candidates. HO. Explanation OH OH molecule OH Shellyy gezon Check NHS 20 CH3 000 000 CH3 Could be in a membrane? Oyes Ono O yes Ono g 8 yes no yes no Membrane would be to the..? + left right → + left + left + left MacBook Pro right → right → right → X 5 ? 圖 图〗 olo Ar © 2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center | Accessibilityaccount_circle Science Anatomy and PhysiologyQ&A LibraryWhich of the following statements regarding the selective permeability of the lipid bilayer is FALSE? A. the permeability of the lipid bilayer to different substances varies. B. The lipid bilayer component of the plasma membrane is highly permeable to nonvolatile molecules such as oxygen. C. The more hydrophobic or lipid soluble a substance is, the greater the lipid bilayers permeability to that substance. D. The lipid bilayer component of the plasma membrane is moderately permeable to ions and large, uncharged polar molecules Which of the following statements regarding the selective permeability of the lipid bilayer is FALSE? A. the permeability of the lipid bilayer to different substances varies. B. The lipid bilayer component of the plasma membrane is highly permeable to nonvolatile molecules such as oxygen. C. The more hydrophobic or lipid soluble a substance is, the greater the lipid bilayers…11:28 PM Fri Oct 9 * 29% O T of + : Oct 8, 2020 at 2:10 PM NAME DATE PERIOD Cell Membrane Discovery Big Idea: Cells move materials in and out of their environment through the cell membrane in order to maintain (balance) or (equal state). Composition of the Cell Membrane & Functions: The cell membrane is also called the membrane and is made of a phospholipid The phospholipids have a (water attracting or polar) head and two (water repelling or non-polar) The head of a phospholipid is made of an alcohol and phosphate group, while the tails are 2 chains of fatty acids. Phospholipids can move apart and allow water and other molecules to pass through into or out of the cell. This is known as simple because it does not require and the molecules are moving from areas of concentration to an area of concentration. 1. LABEL a phospholipid bilayer coloring the heads red and the tails blue. 2. LABEL the structure that is hydrophobic and hydrophilic. PHOSPHOLIPID molecule membrane Another type of…
- Integral membrane proteins... Choose all that could apply are bound to the membrane by only interacting with the phospholipid's polar head O contain many amino acids with hydrophobic residues O contain alpha-helical membrane spanning domains O would not be digested by trypsin in a permeabilized cell O interact with the phospholipid core of the phospholipid bilayerWhat's More Since you have already learned the principal components and functions of the cell membrane, the activity below is provided for you. The table below consists of three columns with the pictures found in the first column. Then, on the second column, you have to write the component of the cell membrane which is analogous to the presented pictures/illustrations. You can choose between PHOSPHOLIPID, CARBOHYDRATE, CHOLESTEROL, INTEGRAL PROTEINS, and PERIPHERAL PROTEINS which may be used more than once. Lastly, on the third column, you have to write the SPECIFIC FUNCTION of the component of the cell membrane that is depicted by each picture/illustration. PHOTO - COGNITION Component of the cell membrane being described Function being portrayed Picture Merle"Which of the following cell processes depend on the movement of membrane components and would not be possible if membranes were rigid, nonfluid structures?" cell movement cell division cell eating (phagocytosis) or cell drinking (pinocytosis) all of the given are not possible with rigid nonfluid structures.
- Given the following compositional assessment of a cell membrane, describe from ER to cell membrane how this composition was synthesized and why it is asymmetric? Cytoplasmic face Non-cytoplasmic face PI 25 8 PC 6 22 SM 4 23A2 Which of the following statements is NOT correct about the phospholipid molecules in the plasma membrane? * O The polar heads face outward The nonpolar tails face inward. O The polar heads are hydrophobic. O The nonpolar tails are hydrophobic. The phospholipids form a bilayer. This is a required questionAll the following is a function of membrane proteins EXCEPT: Cell-cell contact O Protein synthesis Transporting substances cross the membrane O Enzymatic activity which of the following sentences are INCORRECT: All living things are composed of one cells all cells have the same size The cell is the basic structural, O functional, and biological unit of all organisms Robert Hook discovered the cells
- What major type of molecule contributes to the formation of the cell membrane and what biochemical properties of this molecule promotes the formation of the membrane? What effect allows this type of molecule to come together to form a bilayer and explain how the effect works? A▾ B I I e 2 2b) Cellular membranes are generally found in environments that contain lots of water. Draw a diagram of what the phospholipid bilayer of a plasma membrane would look like if it were placed in a hydrophobic environment. (**Note that you only have to draw the phospholipid bilayer, you don't have to draw the other major components again as you did in part a) poned In salt wer (ho byorout obods f.Cplan why sctive tnsport is requind in tive tre nolaib beisio c) What part or parts of a cellular membrane play(s) a role in determining the fluidity of the membrane? pslomlo belowAt this point, go over your answers to the activit ies given earlier in this lesson before you fill out the table below. Table 20: Interdependence of Function and Fom in the Cell Membrane Which components of the cell membrane enable it to perform this function? Function of the Cell Membrane How do these components help the cell membrane in performing this function? iully control the passage of substances through its membrane. However, all activit ort, involve energy. This leads us to another characte As stated in the first section of this lesson, maintaining homeostasis requires ise this in powering