Bio-123 Molecular Biology Part 1 Post/ Part 2 Pre Lab The following is a restriction map for the DNA of YIPS, a plasmid that is 5,541 base pairs (bp). The numbers indicate the location (in terms of the base pairs) of the restriction sites for each enzyme, Use the maps to answer the following questions Hindll 32 EcoR1 1/5541 Pvul 4916 Eagl 942 Apal 2035 Pvull 3247 Smal 2540 5. How many fragments would be produced if this plasmid was digested with both EcoRI and Eagl? a. What would be the size of each fragment? 6. How many fragments would be produced if this plasmid was digested with three enzymes: Hind II, Apal & Pvu lI? a. What would be the size of each fragment? 7. How many fragments would be produced if this plasmid was digested with four enzymes: Hindlll, Apol Pvul, & Pvull? a. What would be the size of each fragment? Molecular Biology Part 1-2 Post Lab V1 Short.Docx Page 4 Revised 12/2/2019

Bio-123 Molecular Biology Part 1 Post/ Part 2 Pre Lab The following is a restriction map for the DNA of YIPS, a plasmid that is 5,541 base pairs (bp). The numbers indicate the location (in terms of the base pairs) of the restriction sites for each enzyme, Use the maps to answer the following questions Hindll 32 EcoR1 1/5541 Pvul 4916 Eagl 942 Apal 2035 Pvull 3247 Smal 2540 5. How many fragments would be produced if this plasmid was digested with both EcoRI and Eagl? a. What would be the size of each fragment? 6. How many fragments would be produced if this plasmid was digested with three enzymes: Hind II, Apal & Pvu lI? a. What would be the size of each fragment? 7. How many fragments would be produced if this plasmid was digested with four enzymes: Hindlll, Apol Pvul, & Pvull? a. What would be the size of each fragment? Molecular Biology Part 1-2 Post Lab V1 Short.Docx Page 4 Revised 12/2/2019

Name: number 5 and 5a Bio-123 Molecular Biology Part 1 Post/ Part 2 Pre LabT
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: number 5 and 5a Bio-123 Molecular Biology Part 1 Post/ Part 2 Pre LabThe following is a restriction map for the DNA of YIPS, a plasmid that is 5,541 base pairs (bp).The numbers indicate the location (in terms of the base pairs) of the restriction sit

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 3DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D
DNA and Protein Synthesis Retake Test Using the chart below, what type of mutation would take place if the highlighted and underlined "A" was deleted?: What amino acid sequence would be coded for with this mutation? What would be the affect of this mutation on the organism? i DNA AAT СТА GTA MRNA UUA GAU CAU Amino acid Leu Asp His :: point mutation :: frame shift mutation :: no affect on organism :: affect on organism : Leu - Asp - His :: Leu - Asp - Asp : Stop - lle - ? : Tyr - Met -? 18 19 20 21 22 23 24 25 96
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
Restriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction enzymes (single and double-cut) resulted in the fragments below. Draw a restriction map of the plasmid using the data provided below A. PCHEM 1234. Shown below are the restriction fragments BamHI 52 kb Hind III 26, 12, 8, 6 kb BamHI and HindIII double digest 14, 12, 8, 6 kb
Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864
Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020 (Before the beginning of the class) Name ID Instruction: 1. Print this document (US-letter only) Fill the table below with the appropriate color (see coloring rule) 3. Complete and annotate the drawing in attachment (see page #2). Make sure all the listed terms are present in your final drawing! (graded using 5 randomly selected terms 2. This type of drawing makes only sense for Eukaryotes/Prokaryotes (circle one) because: or The annotation must follow the coloring rule : DNA in BLACK. RNA in RED. Proteins and AAs in GREEN. Complex structures with some DNA and/or RNA and/or Proteins in BLUE. Color Color Color DNA DNA pol III Stop codon RNA RNA polymerase 5'-UTR Peptide Helicase 3'-UTR Leading strand Topoisomerase CDS Lagging strand Ligase RBS Coding strand Primer Ribosome SSU Template strand -10/-35 Box Ribosome LSU 5'/3' ends (all) Transcription start AA-TRNA N-/C- terminal ends…
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?