BglII 6. You have a circular plasmid available, with a single RE site for BglII (A^GATCT). You cleave the plasmid with BglII, and join it to both ends of a linear fragment of viral DNA which was obtained by digesting the viral genome with the RE DpnII (^GATC), resulting in a larger plasmid. ☑ DpnII Text DpnII O If the resulting larger plasmid is incubated with BglII, will the enzyme be able to excise the fragment of viral DNA? If no, why not? If yes, explain under which conditions. Motivate your answer by showing the sequence of the plasmid DNA (in black) and the viral DNA (in blue) at both the join positions. Write out the sequences in dsDNA format, if necessary indicate any flanking nucleotides by N.
Q: Answer the following questions about insulin: Describe DNA methylation and how it impacts gene…
A: Approach to solving the question:Read and understand the question.Answer the questions by…
Q: Construct the scoring scheme for identifying DNA sequences that exhibit at least 65% identity.…
A: In bioinformatics, scoring plans are pivotal for errands such as sequence arrangement and DNA…
Q: As a result of trauma a person left 1 liter of blood. 1 liter of 0.9 % NaCI solution was infused.…
A:
Q: The measles virus has a basic reproduction number (R0) of 15. To achieve herd immunity, what…
A: The basic reproduction number (R0) represents the average number of new infections caused by a…
Q: What does it mean for something to be selectively toxic? Which is more challenging to produce, a…
A: Due to the fact that it is required for medications and chemicals to only cause harm to the…
Q: 16) Bacterial DNA replication is said to be: a) Linear b) curvilinear c) circular d) exponential e)…
A: 16) Bacterial DNA replication is said to be circular. This is because bacterial DNA is organized in…
Q: 1.What would you predict would happen if you added Anti-A serum to this type of blood? 2. What would…
A: Let's break down the answers to each question in more detail:1. When Anti-A serum is added to Type B…
Q: 1. According to the theory of island biogeography, which island will have the highest immigration…
A: Given important information based from the figure above:Size: Island A is the largest. Islands B, C,…
Q: Threatened or Endangered: At least a few individuals are still present
A: The terms "threatened" and "endangered" are both used to describe species at risk of extinction, but…
Q: Please explain what is Naegleria Fowleri and why is it so important. Also, by temperatures rising…
A: References:https://www.cdc.gov/parasites/naegleria/general.htmlhttps://www.ncbi.nlm.nih.gov/pmc/arti…
Q: 26-27) List all the antibiotics in the above table that work through inhibiting replication (if…
A: Self explanatoryHope the answer was helpful. If any doubts feel free to ask for further…
Q: What is the effect of lowered pH on the proteins found in dairy products during lactic acid…
A: Lactic acid fermentation, also known as lactic acid, is a key biochemical process used by the dairy…
Q: answer only question g
A: Step 1:The anticodon sequence will be…
Q: You are studying RNA viruses and have discovered one that grows well in a culture of eukaryotic…
A: By treating the cell culture with cycloheximide and observing whether the virus replicates its…
Q: Why might it be advisable for an Rh–woman who has had an abortion, miscarriage, or an ectopic…
A: The Rh factor is something on red blood cells. A few individuals have it (called Rh+) and a few…
Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…
A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…
Q: Suggest the most appropriate organic/aqueous medium for use in determining P values in the following…
A: Partition coefficients (P values) are vital in understanding how a medication or chemical carries on…
Q: Sickle cell disease (SCD) affects millions of people throughout the world; the CDC "Centers for…
A: Detailed explanation:Sickle cell disease (SCD) is a genetic disorder characterized by abnormal…
Q: There are two tubes invovled with the passage of the sperm from the epididymis to the outside. What…
A: The objective of the question is to identify the two structures or tubes that facilitate the passage…
Q: What is the advantage of homology-directed repair (HDR) ?
A: One of the most vital cellular processes called homology-directed repair (HDR) is capable for fixing…
Q: List the traits that land plants share with green algae in general and with charophyte algae in…
A: Land plants, or embryophytes, are accepted to have evolved from aquatic ancestors, specifically from…
Q: Why two strands of DNA are synthesized differently
A: Certainly! Let's break it down further.1. DNA Structure and Complementary Base Pairing:DNA, the…
Q: True or False : CRISPR is a novel method for reliably amplifying gene products so that they can be…
A: Certainly! CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a groundbreaking…
Q: The gel image below shows 7 alleles, let’s call them 1-7 in order of size, with 1 being the largest…
A: Detailed explanation: Let's delve deeper into how to analyze a gel electrophoresis image to…
Q: Viruses are obligatory parasites. When bacteriophages infect a cell, there would be two possible…
A: Detailed explanation:Structure of T-even Bacteriophage:The T-even bacteriophage, a member of the…
Q: What is the main factor that differentiates genetic drift from natural selection? 1. Genetic…
A: The main factor that differentiates genetic drift from natural selection lies in the mechanism…
Q: please solve this step by step with clear explaination
A: To convert the given amounts of DNA from micrograms (μg) to microliters (μl), we need to use the…
Q: How can gene flow impact a population's allele frequencies? Choose one of the following: By…
A: The objective of the question is to understand how gene flow can impact a population's allele…
Q: Sanger sequencing (aka the chain termination) a. is a method for for determining the sequence of…
A: Without a doubt!Identifying the order of nucleotides in a section of DNA may be accomplished by the…
Q: Part A Which of the following statements concerning restriction enzymes is true? Select all that…
A: The correct statement is option C. "Some restriction enzymes generate overhangs in the target DNA…
Q: The article I read was about the species “Australopithecus Afarensis” which most people can relate…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: Why do positive feedback systems that are part of a normal physiological response include some…
A: Positive feedback loops are fundamental to physiological processes. This framework is fundamental in…
Q: 1. The survivorship curve above is characteristic of what type of species? Choice 1 of 3:Type I…
A: Survivorship curveSurvivorship curves are graphs that depict the percentage of a population that…
Q: Part 3 - Label the structures indicated in the transverse abdominal section shown. 2. 3. 1. 4. 5. 6.…
A: Here's a brief overview of each of the anatomical structuresVertebra:Vertebrae are the individual…
Q: hat is the dose in mSv for 2.5 mGy of neutron exposure to the eye?
A: To calculate the measurements in millisieverts (mSv) for neutron presentation, especially to…
Q: 44. The use of chemical agents to kill or inhibit the growth of microorganisms within their host’s…
A: The answer is d) chemotherapeutic, and here's a breakdown of why the other options are less…
Q: You are conducting an ecological study of two populations of invasive Italian Wall lizards in New…
A: 1. **Estimated Population Size Comparison:** - In the Bronx, you marked 18 lizards initially and…
Q: 2. What was the average velocity (mean speed) of the above object, when considering the entire time…
A: average speed doesn't account for the direction of the motion. Here's why:The object is falling,…
Q: When Mendel crossed yellow-seeded and green-seeded pea plants, all the offspring were yellow-seeded.…
A: The allele for yellow seeds should be written in uppercase letters, while the one for green seeds…
Q: Match the definitions on the left with the vocabulary words on the right. The level of diversity…
A: The number of different species within a specific region or area. -> Species diversity. The…
Q: How many types of forces do we have
A: Types of forces:There are only 4 fundamental forces in nature: Gravitation: force between the…
Q: A young child (2 years old) has developed a nasty chest cold that has lasted for nearly 2 weeks, and…
A: 1. Disease and Infectious Agent: Pertussis, commonly known as whooping cough, is a highly contagious…
Q: Calculate the amount of protein (in mg) in Sample 1 if the measurement at A280 = 0.636, taking into…
A: The amount of protein in a sample can be found by using a special machine that measures how much…
Q: Genetics Q5
A: The objective of the question is to understand the effectiveness of gene therapy in treating genetic…
Q: Distinguish between dehydration synthesis and hydrolysis.
A: In science, numerous crucial processes include synthesizing and breaking down complex particles. Two…
Q: Which of the following statements is correct about the development of T cells? O After many cell…
A: T cells, including CD4+ T cells (T helper cells) and CD8+ T cells (cytotoxic T lymphocytes), develop…
Q: haploid 1. 15. Meiosis creates what type of cell: sex cells. Fill in the Blank with the proper phase…
A: In meiosis, a type of cell division that produces gametes (sperm and eggs), there are two rounds of…
Q: How do we assign fossil specimens to biological species that are recognized today?
A: Recognizing fossil specimens and connecting them to modern-day biological species is a vital and…
Q: dont provide handwriting solution ...
A: When dealing with circular DNA containing multiple EcoRI recognition sites, the digestion pattern…
Q: everything to know about viruses and bacteria
A: Microorganisms are minute organisms that are not visible to the naked eye and can only be seen under…
Step by step
Solved in 2 steps
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…COMPLEMENTARY BASE PAIRING 1. A B. C. D. E. F OMPTON 2. A. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus 77174: ATG TGTCA AAGACGGT CCTGTTTTGTA CCGTCAGGATTGA 6 GTTTTCATGCCTCCAAATCTT 10 The DNA of each species has a different base composition. Find the base composition of each species, using what you know about complement Human DNA is approximately 20%C
- I-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.2AQ:You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one bluecolony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to find that the plasmid from the blue colony contains a verysmall insert of approximately 60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
- PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |Genome for C. diphtheriae have about 2,500,000 nucleotides, 87% of them are coding. This ingle circular chromosome contains 2,389 genes from which 2,272 proteins are coded. It does not contain any plasmids. The genome contains Pathogenicity Islands (PAIs), which C. diphtheriae has 13. What is a PAI and what are their characteristics?Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D
- You first need to create a plasmid. What are the minimal components necessary to develop this plasmid? In addition to these components, please draw the plasmid. In this illustration, I am looking for the components, the direction of transcription (i.e., the direction the genes will be transcribed), and what should be transcribed last? Also, where would you specifically insert the P. falciparum gene in this plasmid, and why are you checking reading frames in your gene? Finally, please name your plasmid using the correct nomenclature too. You are excited you have this new plasmid; you want to transfect it into P. marinus and provide it as an oral vaccine to laboratory mice. However, even though your supervisor enjoys your enthusiastic attitude, they do not allow you to do this quite yet because all you have is this plasmid. Why doesn’t your supervisor allow you to use the laboratory mouse for this research regarding animal welfare guidelines? Your answer should include the 3 R’s of…You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…