Homework Help is Here – Start Your Trial Now!
Science
Biology
A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP 1020 IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V-340 IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 V.1 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid PSEN-1 -YGGCGGNRNNFDTEEY CMA-V-340 IV.1 361 V.2 361 Amino Acid DTETVGQRAT HSTINAAT MT CATACCCACACTCTCCCCCACACACCCCTCCACTCAATTCTCAATCCTCCCATCATCATC 420 420 140 GATACCGAGACTATE SOCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC TV.2 361 GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC 120 v.1 361 CACACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCATCCTCCCATCATCATC 420 Amino Acid -DTETVGQRAHSILNA AIM-T- 140 PSEN-2 IV.1 421 AACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 V.2 421 AACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 Amino Acid -N--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 160 Select one: True O False 480 IV.2 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC V.1 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 Amino Acid -Y--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 160 Fig.2 Gene sequencing analysis results for Amyloid Precursor Protein (APP), Presenilin-1 (PSEN-1) and Presenilin-2 (PSEN-2) from individuals IV.1, V.2, IV.2 and V.1. The DNA sequence for each individual is given with the corresponding amino acid sequence noted beneath. A point mutation was identified in the DNA coding sequence of each of these regions for the 3 genes and is highlighted in red. Using the information in Figure 2 and your background knowledge, answer questions 7 to 8. Question 7) The most likely cause of early onset Alzheimer's disease in patient V.1 is a silent mutation

A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP 1020 IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V-340 IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 V.1 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid PSEN-1 -YGGCGGNRNNFDTEEY CMA-V-340 IV.1 361 V.2 361 Amino Acid DTETVGQRAT HSTINAAT MT CATACCCACACTCTCCCCCACACACCCCTCCACTCAATTCTCAATCCTCCCATCATCATC 420 420 140 GATACCGAGACTATE SOCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC TV.2 361 GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC 120 v.1 361 CACACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCATCCTCCCATCATCATC 420 Amino Acid -DTETVGQRAHSILNA AIM-T- 140 PSEN-2 IV.1 421 AACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 V.2 421 AACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 Amino Acid -N--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 160 Select one: True O False 480 IV.2 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC V.1 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 Amino Acid -Y--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 160 Fig.2 Gene sequencing analysis results for Amyloid Precursor Protein (APP), Presenilin-1 (PSEN-1) and Presenilin-2 (PSEN-2) from individuals IV.1, V.2, IV.2 and V.1. The DNA sequence for each individual is given with the corresponding amino acid sequence noted beneath. A point mutation was identified in the DNA coding sequence of each of these regions for the 3 genes and is highlighted in red. Using the information in Figure 2 and your background knowledge, answer questions 7 to 8. Question 7) The most likely cause of early onset Alzheimer's disease in patient V.1 is a silent mutation

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420 GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC 120 140 DTETV GQRAT HSTI. NAAT MT TV.2 361 GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC 120 V.1 361 GACACCGAGACTCTCCCCCAGAGACCCCTCCACTCAATTCTCAATCCTCCCATCATCATC 420 Amino Acid DTETVGQRAIH SILNA AIM-I- 140 IV. 1 421 AACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 V.2 421 Amino Acid -N--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 480 160 Select one: True O False AACACCCTCATCAT GATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC IV.2 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC V.1 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC Amino Acid -Y--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 480 480 160 Fig.2 Gene sequencing analysis results for Amyloid Precursor Protein (APP), Presenilin-1 (PSEN-1) and Presenilin-2 (PSEN-2) from individuals IV.1, V.2, IV.2 and V.1. The DNA sequence for each individual is given with the corresponding amino acid sequence noted beneath. A point mutation was identified in the DNA coding sequence of each of these regions for the 3 genes and is highlighted in red. Using the information in Figure 2 and your background knowledge, answer questions 7 to 8. Question 7) The most likely cause of early onset Alzheimer's disease in patient V.1 is a silent mutation
Transcribed Image Text:A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420 GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC 120 140 DTETV GQRAT HSTI. NAAT MT TV.2 361 GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC 120 V.1 361 GACACCGAGACTCTCCCCCAGAGACCCCTCCACTCAATTCTCAATCCTCCCATCATCATC 420 Amino Acid DTETVGQRAIH SILNA AIM-I- 140 IV. 1 421 AACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC 480 V.2 421 Amino Acid -N--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 480 160 Select one: True O False AACACCCTCATCAT GATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC IV.2 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC V.1 421 TACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTAC Amino Acid -Y--T--L--I--M--I--S--V--I--V--V--M--T--I--F--L--V--V--L--Y- 480 480 160 Fig.2 Gene sequencing analysis results for Amyloid Precursor Protein (APP), Presenilin-1 (PSEN-1) and Presenilin-2 (PSEN-2) from individuals IV.1, V.2, IV.2 and V.1. The DNA sequence for each individual is given with the corresponding amino acid sequence noted beneath. A point mutation was identified in the DNA coding sequence of each of these regions for the 3 genes and is highlighted in red. Using the information in Figure 2 and your background knowledge, answer questions 7 to 8. Question 7) The most likely cause of early onset Alzheimer's disease in patient V.1 is a silent mutation
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomic studies
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS