5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. (Question # 21; Chapter 8-Genetics: An Integrated Approach). o Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAS from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?
Q: Researchers are designing and testing antisense drugs as therapies for a variety of diseases,…
A: An antisense drug is a medication containing part of the non-coding strand of messenger RNA, a key…
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells?…
A: The chemicals or the drugs that are employed to kill bacteria are termed antibiotics. The regulation…
Q: During transcription, how many RNA nucleotide bases would usually be encoded by a sequence of 99 DNA…
A: Transcription is the first step of making a protein from DNA instructions. The human genome is made…
Q: Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?
A: Ribosomal and transfer RNAs are processed in both prokaryotes and eukaryotes. The processing of…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: 1. Draw a schematic of a stretch of DNA (horizontally) in the space below to represent a gene a. Put…
A: DNA deoxyribonucleic acid is a genetic material in many organisms this genetic material inherited to…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Transformation is a process in which bacteria take up new DNA released by dead cells and integrate…
A: When transcription is under positive control, this means that a protein known as an activator binds…
Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…
A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…
Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…
A: Introduction:: The correct choice is option (b).
Q: Why aren't ssb proteins necessary in transcription?
A: The function of SSB protein is to prevent the recoiling of parent strands during replication. As we…
Q: To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of…
A: According to the question, we have to explain to facilitate the movement of mRNA from the nucleus…
Q: .What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…
A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…
Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…
A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.
Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…
A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…
Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…
A: DNA is the genetic material as it contains all the information required to make all the proteins and…
Q: Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic…
A: Single base pair mutation in mRNA transcript in Eukaryotes is less serious because mRNA of Eukarotes…
Q: 5) The bacterial Lac operon is an example of transcriptional regulation. What are the major…
A: Using an example of Escherichia coli for the bacterial lac operon. Escherichia coli is a…
Q: scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial…
A: Transcription is a process in which formation of transcript of RNA from DNA by the process of…
Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…
A: Dr. Francis Crick gave the central dogma of molecular biology which states that the information…
Q: 2. What do you predict would happen if you created-a RNA with an anticodon of 5'-CAA-3' that is…
A: The translation of the proteins takes place as the mRNA having the codons are fitting into the…
Q: 3. You are investigating an abnormal eukaryotic cell line that makes mRNAs much longer than the…
A: mRNAs are single-stranded RNA molecules that are complementary to one of the DNA strands of a gene.…
Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…
A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…
Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Promoter sequence is present in the DNA at the upstream of regulatory gene.
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…
Q: 1)A. how do you read a sequence of DNA (template or non-template strand) to convert it an mRNA…
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: Discuss how mutations may arise in DNA, and the potential consequences…
A: Mutations are the changes in the nucleotide sequence of DNA and it arises at the time of DNA…
Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…
A: Transcription is the process that reads and converts the messages on the DNA template strand into…
Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…
A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…
Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…
A: In this question we have to describe about regulation of genes . See full answer in step 2.
Q: Researchers are designing and testing antisense drugs as therapies for a variety of diseases,…
A: The antisense gene therapy is a form of treatment for genetic disorders. This therapy is also…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: 1. Describe how regulation of the arginine operon would work? Is the repressor activated or…
A: Enzymes are not being expressed, even once arabinose additional to the medium. arginine is a vital…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…
A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…
Q: 3. Finally, directly below the mRNA sequence that you wrote for #2, write the amino acid sequence of…
A: The DNA sequence given in the question would act as a coding stand for the synthesis of mRNA. The…
Q: Suppose you are studying two different mutations in a gene that codes for a protein. In the first, a…
A: Proteins are made up of amino acids that joins together by peptide bonds. The synthesis of protein…
Q: (D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting…
A: mRNA: Messenger RNA It is a type of RNA that plays a very important role in protein synthesis…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…
A: The explanation is given below.
Q: e (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3'…
A: 4a. Following is the amino acid sequence : Methionine Arginine Proline Serine Tyrosine Glycine
Q: 4) RNAI is the name used to describe a system that cells use to shut down the translation of…
A: ANSWER;- RNAi is mainly of two types: small interfering RNA(siRNA)- which are made artificially or…
Q: 1. Suppose there was a mutation in the inducer of the lac operon, such that the inducer was unable…
A: Answer : The lac operon will not reveal its element and remains closed. In the lac operon, the…
Q: 2. įmagine that you and your colleagues are working in a lab to develop a protein synthesis system…
A: The prokaryotes have a polycistronic mRNA while the eukaryotes have a monocistronic mRNA. The mRNA…
Q: f you made a change in the promoter sequence in the DNA that inactivates the promoter, what would…
A: Promoter is present upstream the DNA which contains the binding sites for the DNA polymerase to bind…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Procedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene surface B. A transcription factor bonds to a promoter site C. An mRNA molecule is produced D. The transcript leaves the nucleus E. An MRNA polymerase attaches to the template strand Which if the following shows the correct sequence? ACEDB ЕВАCD ОВАСЕ D EACAD О САВЕD О АВСЕD В АEDC ВЕАСD EABCD#2: Gene Translation How many ribosomes are actively synthesizing proteins at any instant in an E. coli cell growing with a doubling time of 45-minutes? Use the following assumptions in your calculations-- a. The birth size of E. coli is 1 micron in diameter and 2 microns in length. b. Water content of the cell is 80% and 50% of the dry cell mass is protein / enzymes. Also, the density of cell material is approximately 1 gram per mL. c. Rate of amino acid addition per ribosome is 20 amino acids per second, and the average molecular weight of a free amino acid is 126.
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)
- You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5'-AUGCCCAGAGCU-3' Which mutation is a frameshift mutation that changes all of the amino acids that follow the changed sequence? O 5-AUGCCCUGAGCU-3' 05-AUGCCCCAGAGCU-3" 05-AUGCCCACAGCU-3" 05 AUGCCCAGGGCC-3"The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.1a.Describe the information flow in the central dogma. 1b. How does a gene specify the production of a protein? Explain in words and illustrate in a figure.
- Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA templateResearchers are designing and testing antisense drugs as therapies for a variety of diseases, inclusing cancer, AIDS, diabeates, and muscular dystrophy. The drugs are also being tested to fight infection by deadly viruses such as Ebola. Antisense drugs consist of short RNA strands coplementary in sequence to mRNAs that form during the progression of a disease. How do you think these drugs work?What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.