4. Zymogens are an interesting class of proenzymes. Describe the biochemical changes that have to occur for these proenzymes to be active using the blood clotting cascade versus the insulin cascade.
Q: 1. How do we measure and define evolution? 2. Evolution occurs: 1. at the level of the individual.…
A: Understanding evolutionary biology involves exploring the mechanisms driving the diversity of life…
Q: The salamanders of the genus Ambystoma in northeastern North America are an entirely female…
A: The salamanders of the genus Ambystoma in the northeastern North America are an interesting example…
Q: What is an anticodon and where is it located on the tRNA structure?
A: The anticodon is a distinctive three-nucleotide sequence present on transfer RNA (t RNA) molecules.…
Q: Give correct typing answer with explanation
A: A triglyceride is composed of two main components such as glycerol and fatty acid.Explanation:A…
Q: Aristotle agreed with Plato’s student Eudoxus that the center of the universe (about which all…
A: The question is asking about the geocentric model of the universe, which was proposed by ancient…
Q: An electron photomicrograph of a newly discovered cell shows long projections with a basal body in…
A: A cell is the basic structural and functional unit of life. All living organisms are made up of…
Q: In Aristotle’s scala naturae, the zoophytes (like sponges and sea anemones) possess: nutritive…
A: The objective of the question is to understand the classification of zoophytes (like sponges and sea…
Q: Describe the main jobs of each of the following enzymes in the E. coli model of replication: A. DNA…
A: In E. coli, DNA replication is a complex process involving multiple enzymes. A. DNA Polymerase I:5'…
Q: Examples of GMOs Correctly classify examples of bacteria, plants, and animals that have been…
A: Genetically Modified BacteriaGenetically Modified PlantsGenetically Modified Animals All Genetically…
Q: Which of the following logical statements takes the form of an Aristotelian syllogism? if all…
A: The objective of the question is to identify which of the given logical statements fits the form of…
Q: 3. Sickle cell disease is an autosomal recessive genetic disorder that affects the shape of red…
A: a. To determine if the population is in Hardy-Weinberg Equilibrium (HWE), we need to compare the…
Q: good “phylogenetic” species is one that is A. The smallest diagnosable cluster of organisms within…
A: A species has been defined by several researchers and their theories have been placed differently as…
Q: In the adult, neurons are an example of which of the following? A. Continuously dividing cells B.…
A: The question is asking to identify the type of cells that neurons in an adult belong to. The options…
Q: Proteins like channels embedded within the cell's plasma membrane and enzymes scattered in the…
A: Protein synthesis is a complex biological process that involves transcription of the gene into mRNA…
Q: A patient presents with fibromyalgia (FM) in your clinic. We all know that because of the unique…
A: Chronic fibromyalgia is typified by diffuse musculoskeletal pain, exhaustion, irregular sleep…
Q: Which of the following fitness relationships among three genotypes at a single locus represents the…
A: Overdominance, also known as heterozygote advantage, is a phenomenon in genetics where the…
Q: Why are the catecholamines listed for a variety of receptor pathways?
A: The objective of the question is to understand why catecholamines, a type of neurotransmitter, are…
Q: Which of the following is required to transport fatty acids across the inner mitochondrial membrane?…
A: The question is asking about the molecule that is required for the transport of fatty acids across…
Q: Exercise 2: Natural Selection 4. The different types of beaks on Darwin's finches can be thought of…
A: Each seed within a type (e.g., sunflower seed) will have slight variations in color, shape, or even…
Q: Anaerobic Metabolism (Glycolysis AND fermentation) diagram drawing with arrows for CBC250 cell…
A: Production of ATP in the absence of oxygen is called anaerobic metabolism.It takes place when there…
Q: Question 3: Both hypokalemic periodic paralysis and hyperkalemic periodic paralysis are dominant…
A: Hypokalemic and hyperkalemic periodic paralysis result from mutations in genes encoding…
Q: L, R, P and D are four genes located on the same chromosome in a diploid organism. Map distances…
A: Genetic mapping is a technique to determine the relative position of genes on a chromosome and their…
Q: The diagram below represents the ranges of 3 species (A, B, and C), which are separated by a…
A: The mechanism by which populations diverge to become new species is known as speciation. The word…
Q: Choose the most likely answer
A: (A) The results were an artifact, because environmental conditions were not taken into…
Q: 5. The color of the hull in oat seeds are determined by two genes that independently assort. The…
A: a. In the diagram below, please fill out the blue areas. In the rectangles, please fill in…
Q: What is the relationship between a pioneer species and primary succession? A…
A: The objective of the question is to understand the relationship between a pioneer species and…
Q: Which of the following would be a good example of premating reproductive isolation?
A: Premating reproductive isolation refers to mechanisms that prevent individuals of different species…
Q: What is the role of gp120 in HIV infection?
A: The virus known as HIV (human immunodeficiency virus) targets the immune system of the body. HIV can…
Q: Can anyone suggest any scholarly journals, articles, reports, whatever you could help out with that…
A: The objective of the question is to identify scholarly resources that discuss problematic species…
Q: What is the effect on acetoacetate blood concentration as weeks without food increases
A: Initial Increase- Initially, acetoacetate blood concentration increases. When the body is deprived…
Q: Which of the following arithmetical series contains only prime numbers (with no composites)? 1, 4,…
A: The objective of the question is to identify the series that contains only prime numbers. A prime…
Q: In Aristotle’s scala naturae, the zoophytes (like sponges and sea anemones) possess: nutritive souls…
A: The objective of the question is to understand the classification of souls in Aristotle's scala…
Q: Brunner's glands secrete an alkaline product that helps achieve optimal pH for the activity of…
A: The question is asking about the location of Brunner's glands, which are known to secrete an…
Q: Based on the same attached figure as above (Figure 10.9 in your textbook), what kind of channel…
A: Mechanoelectrical Transduction K+ channelsExplanation:The type of channel that permits K+ (potassium…
Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…
A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…
Q: Solve only Biology expert if understand. I. Given a polypeptide below, answer the following…
A: Note: Since the student has asked to solve only Q3, I'm going to solve only this question..Amino…
Q: Elevated levels of acetyl-CoA will act as an effector for which of the following enzymes? more…
A: The objective of the question is to identify the enzymes that are affected by the elevated levels of…
Q: Name different types of lubricating agents used in pharmaceutical industries? And explain each of…
A: The objective of the question is to identify and explain the different types of lubricating agents…
Q: Which of the following statements is FALSE regarding oxidative phosphorylation? Oxidation and…
A: Oxidative phosphorylation is a crucial process in cellular respiration, where the majority of ATP is…
Q: Which of the following represent issues of great uncertainty regarding early Earth? Choose one or…
A: All of the above choices (A, B, C, D, and E) represent issues of great uncertainty regarding early…
Q: Operons A. Draw a schematic of the lac operon when glucose is low and lactose is high in the cell’s…
A: The lac operon, trp operon, and lux operon are classic examples of gene regulation in bacteria.…
Q: Familial Down syndrome is similar to primary Down syndrome in that it is caused by trisomy 21.…
A: Two normal copies of 14, two normal copies of 21: A.Two normal copies of 21, one normal copy of 14:…
Q: What role do transcription factors play in transcription?
A: The process of copying genetic information from DNA into a complementary RNA molecule is called…
Q: 3. Which of the following is the like pressure? A) Inhibition of aldosterone sym B) Stimulation of…
A: ACE enzyme is made in large quantities in kidneys. This enzyme plays a very important role in…
Q: In a monohybrid cross with garden peas, you start with a strain with round seeds and a strain with…
A: In pea plants the seed shape is determined by two alleles. The dominant allele is responsible for…
Q: What do restocking programs for wild animals involve? Releasing individuals…
A: Restocking programs for wild animals involve a variety of strategies aimed at increasing the…
Q: IUCN Threat Category griculture & aquaculture esidential & commercial development mergy production &…
A: The chart shows number of species present in threatened category in US affected by different…
Q: A 27-year-old male presents to the doctor with complaints of "heartburn" and painful, sour-tasting…
A: The question is asking about the type of mucosa that is normally found in the distal esophagus. The…
Q: what is background extinction rate
A: The objective of the question is to understand the concept of background extinction rate in biology.
Q: 2. After being bitten by a poisonous snake, a patient will receive a mixture of antibodies against…
A: When an individual is bitten by a deadly snake, the poison can deliver dangerous physiological…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- A diabetic who injects too much insulin can lose consciousness. Explain why injecting excess insulin could impair brain function. Glucagon reverses this effect. Explain how.8. In patients with diabetes mellitus type I, the biochemical disorders result from changes in fucl metabolism. One of these signs is acidosis. Explain why such patients have a deviation of blood pH from the norm? For this me the Ocuics, name d) specify the hormone that accelerates this preeursor formation and provide appropriate charts, starting from the hormone binding to adipocyte and concluding with precursor formation, give an explanation to the charts.WA 82. Regulation of cellular metabolism by insulin requires activation of the insulin-receptor substrate protein-1 (IRS1). Some individuals who have type 2 diabetes mellitus have mutations in the IRS1 gene. Which of the following normal steps in insulin signaling is most likely to be impaired by these mutations? A) Cleavage of IRS1 by the insulin receptor B) Phosphorylation of IRS1 by the insulin receptor C) Production of inositol 1,4,5-trisphosphate by IRS1 D) Stimulation of a G protein by IRS1 E) Synthesis of diacylglycerol by IRS1
- 6. A. List all of the ionizable functional groups that are found in insulin when in aqueous solution. List which amino acid residues have these ionizable groups and list all of the pka and pKb values (including the R groups) that are on both polypeptide chains that make up insulin. (see the table at the end of this HW set; note that tyrosine and cysteine both have unusual pka's, since these side groups ionize above the pKR's given to have a negative charge). B. The isoelectric point of insulin is reported to be around 5.3-5.35. Using the method covered in class, estimate the isoelectric point of insulin and compare your answer to the values above. C. For a polypeptide to be soluble in an aqueous solution, is it good to be near the isoelectric point? Why or why not? Notes: a couple of unusual R group's that ionize (cysteine and tyrosine have R groups that have pka values; histidine has a pkb). The table at the end of this homework set (also in the lecture notes) lists the pka's and…Endocrine & Signalling 26. HO- NH2 HO- The molecule above is a hormone. Select FOUR statements that are correct with regard to this moelcule below. This is the least active form of this hormone There is another more active form of this hormone This molecule is derived from tyrosine This hormone stimulates fat metabolism Biosynthesis of this molecule requires iodine This molecule is a tryptophan metabolite This hormone targets two specific receptors This hormone stimulates fat storage This molecule is derived from cholesterol This hormone is synthesised in the adrenalsDiabetes mellitus is characterized by insufficiency of thepancreas to produce enough insulin to regulate the blood sugarlevel. In type I diabetes, the pancreas produces no insulin, andthe patient is totally dependent on insulin from an externalsource to be infused at a rate to maintain blood sugar levelsat normal levels. Hyperglycemia occurs when blood glucoselevel rises much higher than the norm (>8 mmol/L) for pro-longed periods of time; hypoglycemia occurs when the blood sugar level falls below values of 3 mmol/L. Both situations canbe deleterious to the individual’s health. The normal range ofblood sugar is between 3.8 and 5.6 mmol/L, the target rangefor a controller regulating blood sugar.A patient with type I diabetes needs your help to maintainher blood sugar within an acceptable range (3 mmol/L<glucose<8 mmol/L). She has just eaten a large meal (a disturbance) that you estimate will release glucose accord-ing toD(t)=0.5e−0.05t,wheretis in minutes andD(t)is inmmol/L –…
- 1. Where is insulin synthesised and in what form is it stored in the body?2. Describe the mechanism of release of insulin into the bloodstream.28. functional insulin required the association of two polypeptides known as the A and B chainsLantus differs from "normal" insulin in that: Select one: Oa. The usual insulin molecule has been combined with zinc isophane Ob. A glycine has been substituted in at A21, and two new arginines have been added as B31 and B32 *. An aspartic acid has been substituted for proline at B28 Od. A "C-peptide" chain has been added Oe The proline at B28 and the lysine at B29 have been reversed
- Novolog differs from "normal" insulin in that: Select one: a. An aspartic acid has been substituted for proline at B28 b. The proline at B28 and the lysine at B29 have been reversed c. A glycine has been substituten in at A21, and two new arginines have been added as B31 and B32 d. A "C-peptide" chain has been added e. The usual insulin molecule has been combined with zinc isophane1.a. Given what you know about glycolysis and gluconeogenesis, does it make sense that insulin activates PDH phosphatase? Why? b.How do vitamins increase to the breadth of chemical reactions available within a biological system?3. Regulation of cellular metabolism by insulin requires activation of the insulin-receptor substrate protein-1 (IRS1). Some individuals who have type 2 diabetes mellitus have mutations in the IRS1 gene. Which of the following normal steps in insulin signaling is most likely to be impaired by these mutations? OA) Cleavage of IRS1 by the insulin receptor OB) Phosphorylation of IRS1 by the insulin receptor OC) Production of inositol 1,4,5-trisphosphate by IRS1 D) Stimulation of a G protein by IRS1 E) Synthesis of diacylglycerol by IRS1