11.71 Provide the three-letter amino acid sequence expected from each of the following mRNA segments: a. 5 'GGC|AUC|UACICGA3' b. 5 'CUA AGC|UUC|AAC|UGG3' c. 5 'GUA CGU |CGG|UUA CCA|ACC3'
Q: Your roommate works in a research lab focusing on improving livestock feed. She you she's working…
A: There are four classes of biological macromolecules: nucleic acids, proteins, lipids and…
Q: Which of the following is an important enzyme involved in the synthesis of cholesterol from isoprene…
A: Acetyl-CoA Formation: Cholesterol synthesis begins with the conversion of acetyl-CoA, a two-carbon…
Q: concentration of hemoglobin in the system not bound resting tissues bound increase concentration of…
A: Transport of oxygen in blood depends upon hemoglobin. Basically hemoglobin has 4 subunits, 2 alpha…
Q: Suppose that each ß-adrenergic receptor bound to epinephrine converts 100 molecules of the Ga…
A: Biochemical signal transduction pathways taking place within lifeforms have the ability to amplify…
Q: G protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs) are two basic receptor…
A: GPCR stands for G Protein-Coupled Receptor a type of cell surface receptor involved in signaling.RTK…
Q: Sarin is an inhibitor of acetylcholinesterase. Draw a mechanism that shows this.
A: Before going into the mechanism by which sarin inhibits acetylcholinesterase, we need to know a bit…
Q: For the reaction E + S ES, what is the [E] if [S] = 0.18 mM, [ES] = 133 uM, and the Kd = 15 uM?…
A: Answer :- The enzyme in this reaction is denoted by E, the substrate by S, and the complex of the…
Q: Consider an enzyme-catalyzed reaction that follows Michaelis-Menten kinetics with KM =3.0 mmol·dm-3…
A: When a substrate (S) binds to the active site of an enzyme (E), it leads to the formation of an ES…
Q: (a) 1 Normalized fluorescence 0.8 0.6 0.4 0.2 0 50 55 OM 0.100 M 0.200 M 0.300 M 0.500 M 1.00 M 2.00…
A: There are four classes of biological macromolecules - proteins, nucleic acid, lipids and…
Q: still don't understand how the final pH was calculated? I don't understand how with the pKa of 2.12…
A: Equation of Henderson-Hasselbalch: The pH of a solution is related to the pKa of the weak acid or…
Q: ... 3: Ascorbic acid (shown below) has two chiral centres, which have been labelled. Assign the…
A: Configuration is the spatial arrangement of atoms or groups around a chiral center. A chiral center…
Q: Frog muscle cells and the solution bathing the cells contain ions at different concentrations. The…
A: Inside the cell, the most abundant ions is K+ (potassium). Therefore for the calculation of membrane…
Q: Suppose you visit the Dalai Lama in Dharamsala, India (elevation 1460 m), and you begin to ponder…
A: Fractional Saturation (θ) is the fraction of protein molecules saturated with ligands. (since it is…
Q: 2. Cofactors, coenzymes, and prosthetic groups are important non-protein substances that are…
A: Enzymes are proteins that catalyze biochemical reactions. Enzymes sometimes require a non-protein…
Q: 200 microliters of a standard solution of 0.200 mg/mL caffeine was mixed with 4.8 mL of 50 mM sodium…
A: Equation of dilution: M1 × V1 = M2 × V2where:M1 is the molar concentration of the stock solution.M2…
Q: An enzyme with an unknown reaction mechanism has been isolated and is being investigated in the lab.…
A: General acid/base: proton transfer occurs between enzyme and substrate. Note that water is not a…
Q: Consider the role of Histidine in the Serine protease mechanism and sketch a plot showing he…
A: Enzymes are biological catalysts that increase rate of biochemical reactions.Serine proteases are…
Q: 5. How would you classify B and c? What are they used for? Are A and D diastereomers? Are A and D…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are simplest carbohydrates:…
Q: 1. Ifa Lineweaver-Burk plot gave a line with an equation of y=0.25 x +0.34, what are the values of…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions.Most enzymes are…
Q: You discover a new organism that contains enzyme that can break down beta(1,4) glycosidic linkages,…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: Which of the following is characteristic of competitive inhibitors? the inhibitor could bind to the…
A: Inhibitors can be broadly classified into reversible and irreversible inhibitors. Reversible…
Q: Part A Why does it make biochemical sense that chaperones recognize hydrophobic surface area? What…
A: There are four classes of biological macromolecules- proteins, nucleic acid, lipids and…
Q: Lodgum are true TS
A: The biological process of moving molecules or ions across a cell membrane against their…
Q: Model 1 Model 1 Idealized Graphs of Enzyme inhibition Competitive Inhibition FEE Inh. slope How does…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Which of the following vitamins do you expect to enter the cell via diffusion (i.e., NOT need a…
A: Diffusion refers to the movement of a substance from a region of higher concentration to a region of…
Q: Why do ketoses go dehydration reaction much faster than aldoses in Seliwanoff’s test when aldehyde…
A: Seliwanoff's test is a chemical test used to separate aldoses and ketoses, explicitly between…
Q: What is metagenomics?
A: Genome sequencing or DNA sequencing is process by which the order of nucleotides in a given fragment…
Q: calculating the “Activity ([PNPP]) for each Supernatent.
A: Here we are undertaking the acid phosphatase assay. Acid phosphatase enzyme catalyzes the hydrolysis…
Q: guanosine and a water bind in the active site, does not matter in which order. The scissile N-1…
A: During the reaction mechanism by which guanosine is hydrolyzed into guanine and -Ribose, an…
Q: polysaccharides
A: Polysaccharides are part of the complex carbohydrate category, forming from multiple monosaccharide…
Q: Briefly explain the advances in glucose monitoring techniques over the past sixty years.
A: The glucose monitoring techniques refers to the procedures and equipment used to monitor blood…
Q: Question 3 (1 pt): Which positions in adenine and guanine have the potential to form hydrogen bonds…
A: There are four classes of biological macromolecules; nucleic acid, proteins, lipids and…
Q: What is the concentration of B expressed in terms of A if the Kd is 33.0 uM, and the concentration…
A: Information of question
Q: Acetocholinesterase is an enzyme possessing a single active site that metabolizes acetylcholine with…
A: Turnover number (kcat) is the number of molecules of substrates that are converted to product by a…
Q: Find kcat for a reaction in which Vmax is 4 x 10-4 mol-min-1 and the reaction mixture contains one…
A: Kcat or the turnover number is the the number of substrate molecules converted into product per…
Q: For a reaction that proceeds spontaneously from reactants to products, the AG is O less than 0 00 O…
A: Gibbs Free Energy is a thermodynamic function that not only is related to spontaneity but also deals…
Q: (Theme 5) You are testing the role of three proteins (Protein A, Protein B, and Protein C) which…
A: The electrophoretic gel electrophoresis mobility shift assay is also known as EMSA.This assay is…
Q: The characterization of an enzyme usually includes the determination of key kinetic parameters.…
A: vo: initial rate of reaction or rate of reaction when all the enzyme is yet to be saturated with…
Q: PEGylation plays an important role in the formulation of nanoparticle-based therapeutics: mark all…
A: PEGylation is a process in which polyethylene glycol (PEG) molecules are covalently attached to…
Q: Assume that the complete combustion of one mole of glucose to carbon dioxide and water liberates…
A: Given:Complete combustion of one mole of glucose liberates 2870 kJ.ΔG° = -2870 kJ/mol Efficiency of…
Q: You find a novel monosaccharide that contains 4 carbons, with a carbonyl group present at carbon 1…
A: There are four types of biological macromolecules- proteins, nucleic acids, carbohydrates and…
Q: Describe in one page why hydrogen, carbon, nitrogen, and oxygen can be considered the most important…
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: Metabolizing a fatty acid via the B-oxidation pathway will generate acetyl CoA, NADH and FADH2.…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbons to 36 carbons.…
Q: 26. Draw a figure of a lipoprotein-containing structure that carries lipids.
A: Ingested fat is emulsified in the small intestine by bile salts released from gall bladder to form…
Q: Synthesis of the activated form of acetate (acetyl-CoA) is carried out in an ATP-dependent process.…
A: The nucleotide coenzyme adenosine triphosphate (ATP) is the most important form of chemical energy…
Q: Consider what would happen if you had a pure preparation of each of the substances below, which you…
A: There are four classes of biological macromolecules: nucleic acid, lipids, carbohydrates and…
Q: reaction occurred when the samples (enumerated) reacted with Benedict’s reagent
A: Benedict's test:This test is a chemical assay for reducing sugar.This test involves mixing the…
Q: In glycolysis, how would NADH, ADP and ATP be classified? Would they be considered inhibitors or…
A: The question is asking about the role of NADH, ADP, and ATP in the process of glycolysis, and…
Q: The HIV virus attacks the human immune system causing extensive damage. This virus contains several…
A: Proteins are three-dimensional polymers of amino acid residues linked together via peptide bonds.…
Q: What type of spatula should you use for corrosive ingredients?
A: The objective of the question is to identify the appropriate type of spatula that should be used…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'?
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…17.56 The following sequence is a portion of the DNA template strand: TGT GGG GTT ATT a. Write the corresponding mRNA segment. What are the anticodons of the tRNAS? Write the three-letter and one-letter abbreviations for this segment in the peptide chain. QUA US b. c.
- A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
- Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU