Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23, Problem 11EQ
Summary Introduction
To review:
The parental lineage of the child (1, 2, 3, 4, and 5) with regard to father 1 or father 2.
Introduction:
Sequence tagged site (STS) is a short segment of DNA (deoxyribonucleic acid), comprising 200-500 base pairs. The location of such sequence is known in a genome. This helps in the determination of the physical map of the genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Traditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.
Mr. I. M. Megabucks, the wealthiest man in the world, recently died. Since his death, three women have come forward. Each woman claims to have a child by Megabucks and demands a substantial share of his estate for her child. Lawyers for the estate have insisted on DNA typing of each of the alleged heirs. Fortunately, Megabucks anticipated trouble like this before he died, and he arranged to have a sample of his blood frozen for DNA typing. The results of the typing are shown in the figure below. Your job is to analyze the data and determine whether any of the children could be Megabucks' heir. Remember that every person has two of each chromosome, one inherited from his mother and one inherited from his father. Half of every person's DNA comes from his mother, and half comes from his father, so some of the DNA bands showing in the children will come from their mothers, and the rest will come from their fathers. The question is, could that father be Megabucks?
For the first child,…
b) Mr. Jason has received an identification card regarding his complete genome.
(1) biotechnology tool to develop a complete genome data.
Based on answer b (i). justify the advantages and disadvantages of having a complete genotype card?
Chapter 23 Solutions
Genetics: Analysis and Principles
Ch. 23.1 - Prob. 1COMQCh. 23.2 - Prob. 1COMQCh. 23.3 - A molecular marker is a _____ found at a specific...Ch. 23.3 - 2. Which of the following is an example of a...Ch. 23.3 - To map the distance between molecular markers via...Ch. 23.4 - 1. What is a contig?
a. A fragment of DNA that...Ch. 23.4 - A vector that can carry a large fragment of...Ch. 23.4 - 3. Chromosomal walking is a method of _____ in...Ch. 23.5 - Prob. 1COMQCh. 23.5 - Prob. 2COMQ
Ch. 23.5 - 3. A prokaryotic genome is about 4 million bp in...Ch. 23.6 - Metagenomics is aimed at a. determining the...Ch. 23 - 1. A person with a rare genetic disease has a...Ch. 23 - For each of the following, decide if it could be...Ch. 23 - Which of the following statements about molecular...Ch. 23 - 1. Is each of the following a method used in...Ch. 23 - Prob. 2EQCh. 23 - Prob. 3EQCh. 23 - The cells from a persons malignant tumor were...Ch. 23 - 5. Figure 23.2 describes the technique of FISH....Ch. 23 - Explain how DNA probes with different fluorescence...Ch. 23 - 7. A researcher is interested in a gene found on...Ch. 23 - Prob. 8EQCh. 23 - Prob. 9EQCh. 23 - Prob. 10EQCh. 23 - Prob. 11EQCh. 23 - Prob. 12EQCh. 23 - In the Human Genome Project, researchers have...Ch. 23 - 14. Take a look at question 3 in More Genetic...Ch. 23 - 15. Place the following stages of a physical...Ch. 23 - 16. What is an STS? How are STSs generated...Ch. 23 - 17. Four cosmid clones, which we will call cosmids...Ch. 23 - A human gene, which we will call geneX, is located...Ch. 23 - 19. Describe how you would clone a gene by...Ch. 23 - 20. A bacterium has a genome size of 4.4 Mb. If a...Ch. 23 - 21. Discuss the advantages of next-generation...Ch. 23 - Prob. 22EQCh. 23 - Prob. 23EQCh. 23 - What is a molecular marker? Give two examples....Ch. 23 - Which goals of the Human Genome Project do you...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?arrow_forwardA research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…arrow_forwardThe accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)arrow_forward
- ISSR is generally a dominant STS DNA marker. Nonetheless, with validated experimental evidence (e.g. laboratory and population genetics data), the marker can be used in codominance marker genotyping. Briefly explain each case below: a) Codominant marker targets specific locus and reveals allelic variations in that locus among DNA samples. b) Dominant marker: primers can complement other repeat sequences or in multiple loci thereby non-specificity in sampled genomes.arrow_forwardWhat is a Sanger Sequencing ?arrow_forwardWhat is 15q?arrow_forward
- DNA profiling is used to compare DNA in forensic investigations and paternity disputes. The diagram below shows the DNA profiles of 3 men, a mother and a child. Mother Co Child || | ||| | | 'Dad' 1 | | || 'Dad' 2 છે) (9) (00 'Dad' 3 || || Source: https://ib.bioninja.com.au/standard-level/topic-3-genetics/35-genetic-modification-and/dna-profiling.html Identify the most likely biological father of the child and explain reasons for your choice.arrow_forwardIdentify gene 1( bl, pr, vg) Identity gene 2 ( bl, pr, vg) Identify gene 3 ( bl, pr, vg)arrow_forwardA human gene, which we will call gene X, is located on chromosome11 and is found as a normal allele and a recessive diseasecausing allele. The location of gene X has been approximated on the map shown here, which contains four STSs, labeled STS-1, STS-2, STS-3, and STS-4. STS-1 STS-2 STS-3 Gene X STS-4 A. Explain the general strategy of positional cloning.B. If you applied the approach of positional cloning to clone geneX, where would you begin? As you progressed in your cloningefforts, how would you know if you were walking toward oraway from gene X?C. How would you know if you had reached gene X? (Keepin mind that gene X exists as a normal allele and a diseasecausingallele.)arrow_forward
- If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…arrow_forwardThe DNA profile of each individual is highly specific. The chances of two people having exactly the same DNA profile is 30,000 million to 1 (except for identical twins). Given a set of DNA profiles in figure 3, determine who the father is in a paternity case. The Case: Missis De Los Santos has a daughter who is in need of a liver transplant. Unfortunately, Mrs. De Los Santos was ruled out as a donor. She was asked to ask if her daughter's father could also go for a check-up for donor compatibility. Mrs. De Los Santos believes one of two men is her daughter's father. Who between the men is the daughter's father? Determine who the father in the case is by comparing the DNA profiles of the persons involved in the case. At the end of your profiling activity, you will know that you have correctly figured out who the father is if you have accounted where all the DNA markers of the daughter came from. Figure: Mother Probable Dad 1 Probable Dad 2 Daughter | | || ||||||arrow_forwardAs the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY