Concept explainers
Interpreting Data The Process of Science section in this chapter describes an experiment involving mice with normal and mutant versions of a gene called obese. To determine the role of a specific gene, geneticists often work with two groups of research subjects that differ only in the gene in question (normal version of the gene versus a mutant version of the gene). In this case, researchers compared mice that had two normal copies of the obese gene (called “ob+”) with mice that had two defective copies (called “ob”). The researchers found that mice with two copies of the mutant obese gene (ob/ob) gained significantly more weight than normal (ob+/ob+) mice. Next, researchers sought to determine whether this difference was due to the production of a hormone. To find out, researchers surgically linked the circulatory systems of mice, so that any factor circulating in the blood of one mouse would circulate in the blood of the other. The table below summarizes the results. How do these data support the hypothesis that the obese gene controls the production of a hormone?
Experiment | Genotypes of mice | Average weight gain per mouse (in grams) |
(a) | ob+/ob+ paired with ob+/ob+ | 8.3 |
(b) | ob/ob paired with ob/ob | 38.7 |
(c) | ob/ob+ paired with ob/ob | 8.2 |
Want to see the full answer?
Check out a sample textbook solutionChapter 22 Solutions
Campbell Essential Biology with Physiology (6th Edition)
Additional Science Textbook Solutions
Biological Science (6th Edition)
Microbiology: Principles and Explorations
Microbiology with Diseases by Body System (5th Edition)
Biology Illinois Edition (Glencoe Science)
Biological Science
Seeley's Anatomy & Physiology
- Talk about a antibiotic that inhibits bacteria by inhibiting protein synthesis. Explain how these antibiotics interact with the protein synthesis machinery; what part of the protein synthesis machinery do they bind, and do all of these antibiotics bind to the same part of the machinery? How does this work to stop protein synthesis? Explain how it halts protein synthesis. Are these antibiotics bacteriostatic or bactericidal. Why and what does that mean for therapy?arrow_forwardProtein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?arrow_forwardSuppose you mix the following components of protein synthesis in a test tube: amino acids from a rabbit, ribosomes from a dog, tRNAs from a mouse, mRNA from a chimpanzee, and necessary enzymes plus an energy source from a giraffe. If protein synthesis occurs, which animal’s protein will be made? (a) rabbit (b) dog (c) mouse (d) chimpanzee (e) giraffearrow_forward
- Beadle and Tatum proposed the one gene-one enzyme concept - This hypothesis can now be restated in which of the following ways? A given sequence of DNA nucleotides contains information to make one enzyme Each gene contains information to make one protein, one lipid and one carbohydrate Each gene is actually an enzyme that catalyzes the production of one protein Each polypeptide is the result of the activity of one enzymearrow_forwardGene alteration due to mutagen may cause adverse effect on our life. However, not all mutations can cause undesirable changes in our genes. Discuss THREE (3) effects of mutation and evaluate the possible outcomes in relation to protein production. ? including (introduction, body ,conclusion)arrow_forwardThe link between gene and protein was first articulated by Beadle & Tatum, who proposed the one-gene, one-enzyme hypothesis - which of the following statements contradicts this hypothesis? Sickle-cell anemia results in defective hemoglobin. Two enzymes are able to metabolize the same reaction. Alkaptonuria results when individuals lack a single enzyme involved in the catalysis of homogentisic acid. A mutation in a single gene can result in a defective protein. A single antibody gene can code for different related proteins, depending on the splicing that takes place post-transcriptionally.arrow_forward
- Random mutations only very rarely result in changes in a protein that improve its usefulness for the cell, yet useful mutations are selected in evolution. Because these changes are so rare, for each useful mutation there are innumerable mutations that lead to either no improvement or inactive proteins. Why, then, do cells not contain millions of proteins that are of no use?arrow_forwardIn general, when an organism's lifespan is extended through dietary restriction how does that correlate with visible signs of aging? O They appear as old as a non-dietary restricted individual but their biology is that of a younger individual They appear younger and their biology is that of a younger individual O They appear younger but their biology is that of a non-dietary restricted individualarrow_forwardGene Expression and the Impact of a Mutation. Can someone help me to answer the question 8 and 9, please? 8. How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which includes 2 ẞ-globin polypeptides and 2 a-globin polypeptides) impaired? (Read your book to learn more about sickle cell disease.) 9. What is the relationship between the genotype in this case and the individual's phenotype? asap pleasearrow_forward
- DNA molecule, which embodies genes, the hereditary units, is found in all living things. Science showed that genes could be expressed in any microorganism, meaning that DNA will direct the synthesis of proteins needed for various biological functions and structures.To reduce the costs of production, pharmaceutical companies use biotechnology to generate human insulin in bacteria.Can you describe the steps leading to the production of this hormone in industrial quantities?arrow_forwardSickle cell anemia patients suffer from a distorted red blood cell shape and an anemic condition as a result of a genetic mutation in the HBB gene, which codes for the hemoglobin β subunits. This mutation changes a Glu to a Val at position 6 in the protein, and these patients express two alleles (one from each parent) with this mutation. When individuals inherit just one copy of this mutated gene, they are considered carriers, and have very few symptoms. Based on the quaternary structure of hemoglobin, what can you predict about the assembly of hemoglobin in sickle cell anemia patients versus carriers of the sickle cell trait? a. In sickle cell anemia patients, the α globin subunits have complementary mutations to ensure the quaternary structure of hemoglobin is attained. b. In sickle cell anemia patients, 100% of the hemoglobin is fully functional, whereas in those that carry the trait, there is no functional hemoglobin assembled. c. In individuals with the sickle cell…arrow_forwardThere are close to 200 different cell types in the human body. Why do they look and function differently from one another? O They each express a different set of genes O They each express all the same genes, but in a different order at different times O They each have slightly different genomes O They all express the same genes, but proteins that aren't needed in a particular cell type are degraded before they can function QUESTION 10 When you exercise, you typically start breathing harder. This is because: O You are switching from aerobic to anaerobic respiration O More oxygen is needed to meet the increased ATP demand O Carbon dioxide stores are quickly depleted during exercise Muscle cells can only use aerobic respirationarrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning