You are treating a young boy (age 12) who has been experiences severe episodes of hypoglycemia. Measurement of circulating insulin and glucagon levels indicate that they are normal and responsive to cycles of feeding and fasting. The hypoglycemia can most easily be explained as a defect in which of the following processes? a. adipose tissue HSL activation b. hepatic gluconeogenesis c. renal gluconeogenesis d. skeletal muscle GLUT4 translocation to the plasma membrane
Q: 2.If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…
A: 2. If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…
Q: rections: Create a concept map of homeostasis by filling out the white-filled xes. Afterwards,…
A: Homeostasis It is defined as a process used by living organisms to maintain the optimal functioning…
Q: the humoral response, some B cells differentiate into plasma cells. What do plasma cells produce in…
A: The humoral immune system interacts with antigens obtained from pathogens. These are freely…
Q: Driving Forces An increase of population in Barangay Camp 4 Tuba, Benguet was recorded during the…
A: There are few important points: A population is a collection of individuals of the same species that…
Q: 7. Assuming that these are the 12 microplates. What is wrong with the result of the test? What do…
A: ELISA is an acronym for enzyme-linked immunoassay. Antibodies in the blood are detected using these…
Q: True or false. Dispersal or vicariance may possibly lead to isolation and further to separation of…
A: Biologists group allopatric processes into two categories, first is dispersal and second is…
Q: 15.Where does the complete digestion of food occur in the gastrointestinal tract? Read and analyze…
A: The digestive system is responsible for the digestion, absorption and assimilation of nutrients that…
Q: Please answer part 1A and 1B please I will upvote then with a proper explanation for the correct…
A: Micro satellites are short short DNA segments usually 1 to 6 base pairs that is repeated multiple…
Q: A WBC count is 12.6 x 10^3/μL and there are 14 nucleated RBC's per 100 WBC on the blood smear, what…
A: 1) Given that, WBC count = 12.6 x 10^3/microlitre No.of nucleated RBCs = 14 Corrected WBC count =…
Q: 12.Which is also known as the "voice box" which regulates the air flow into the lungs? Read and…
A: The respiratory system is a network or organs and tissues that help in gaseous exchange i.e., take…
Q: Normal vision father X normal vision ( carrier) mother
A:
Q: In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H…
A: Given: In humans, The genes for red-green color blindness (R = normal, r = color blind) and…
Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…
A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…
Q: The science of producing and transmitting sound waves in materials has become widespread with many…
A: The ultrasonic waves have good propagation in the human body. Thus, it have been widely applied in…
Q: Which of the following statements BEST explains the relationship between the parts of genetic…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: Identify what is being described by each of the following statements. Write your best answer on the…
A: Evolutionary studies Evolution is the change in characteristics over time to survive and reproduce…
Q: In some of the fruits, the floral parts are persistent even up to maturity. Identify these parts.…
A: A fruit is a seed-bearing structure found in flowering plants, often known as angiosperm. Following…
Q: 1. Which of the following Pseudomonas aeruginosa virulence factors has a mechanism of action similar…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: Describe and discuss the concepts of plant growth, development, reproduction, and the basic…
A: All living organisms have the ability to reproduce and grow. Mitosis is the process through which…
Q: All the following are considered acute phase response proteins except: O CRP O Mannose binding…
A: Introduction :- The acute phase response is triggered by an overwhelming immune-inflammatory…
Q: All UI the above Passive facilitated transport across a biological membrane: uses an integral…
A: Introduction : Facilitated trabsport is a type of passive transport i.e no need of energy to…
Q: 3. In poultry, a gene C produces creeper (very short legs) in the heterozygous condition and is…
A: CC genotype produces lethal condition. Cc produces creeper. cc produces normal leg.
Q: cell determination is the expression of the cell's specialized role true or false
A:
Q: Differential lengths of poly-A tails affect mRNA stability. Pre-transcriptional control…
A: According to bartleby guidelines only first question is to be answered. So upload other questions…
Q: Which of the following is a contrast in genetics organization between COVID19’s RNA & human DNA a)…
A: DNA and RNA are the two primary categories of nucleic acids. Nucleotides, which have a five-carbon…
Q: 4During the multiplication of a bacteriophage in its host cell, the specific viral growth phase…
A: Viral replication has 7 stages: Attachment Penetration Uncoating Replication Assembly Maturation…
Q: what reaction activates the amino acids for attachment to the appropriate tRNA before being…
A: Translation is the process of synthesis of proteins from mRNA. It is completed in three steps -…
Q: Thomas hunt Morgan believed genetic mutations were the source if genetic issues and he expoxed flies…
A: The modern synthesis of biology defines the evolutionary theories (Mendelian genetics) that were…
Q: The following DNA sequence is a bacterial promoter with numbered nucleotides. The 3' end is the…
A: Which nucleotide number is the 5' end of 35 site- T Which nucleotide number is the 3' end of…
Q: 9.How does gastrointestinal tract evade dehydration? Read and analyze the question and choices…
A: Introduction Dehydration occurs when your body uses or loses more fluid than it takes in, and your…
Q: Describe in detail how is the Hydrostatic Vascular System (Aquifer) of the Echinoderms. b) Describe…
A: A) The water vascular system is enterocoelic in origin and arises from the left hydrocoel. It…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…
A: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to promoter…
Q: All of the following molecules can act as second messenger Except: O Enzyme O CAMP O Calcium ions O…
A: First messengers are usually extracellular factors. Hormones and neurotransmitters are the examples.…
Q: Make a food web consisting of (rice, cooking oil, oyster sauce, green peas, Onion, Garlic, Egg
A: There are lot of common points in between the several food chains. These common points form the…
Q: Both cartilaginous and bony fishes have______ . a. jaws d. a swim bladder b. a bony skeleton e. a…
A: The term vertebrate is derived from the word vertebrae, which refers to the bones that make up the…
Q: Explain the significance of satellite DNA in DNA profiling technique
A: Deoxyribonucleic acid or DNA is a polymer composed of two polynucleotide chains that coil around…
Q: during development, all cells have different genotypes and gene regulation allows different…
A: ANSWER;- true
Q: You have just gotten back the results from an RNA-seq analysis of mRNAs from liver. You had…
A: RNA-Seq which is expanded as RNA sequencing is described as a sequencing technique that makes use of…
Q: 9. Some biologists contend that the term double fertilization is a misnomer and that the process…
A: Fertlizatiion is the process of the male gamete, sperm, fusing with the female gamete, the ovum,…
Q: major cause of septic shock is the presence of lipopolysaccharide (LPS) from bacteria in the blood.…
A: Septic shock has high modidity and mortality rate due to its effect on circulation in the body which…
Q: Why do impetigo and erysipelas occur more commonly in children than in young adults?
A: INTRODUCTION Streptococcus pyogenes (group A Streptococcus) is a common cause of skin and soft…
Q: 1. The impact of diet on an individual may vary depending on the individual's genetic makeup. II.…
A: Nutrigenomics is the branch of science that investigates the link between nutrition and changes in…
Q: tight packing of previously less condensed chromatin identify which describes the statement…
A: Post translational modifications in histone proteins can change the shape of chromatin, which can…
Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…
A: Twins are two offspring produced by same mother in same pregnancy. Twins can be identical and non…
Q: A bacterial cell with the genotype: lacl* lacp+ laco lacz* lacy* is in a low/absent glucose,…
A: Lac operon is an example of gene regulation in prokaryotes. Lac Operon is a group of genes with a…
Q: Discuss the process of aromatizing (how does this happen)? And why doesn't this happen in genetic…
A: * Aromatization is the biochemical process in which aromatase Enzyme catalyzes the conversion of…
Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…
A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…
Q: In lysogenic conversion, (a) bacterial cells may exhibit new properties (b) the host cell dies (c)…
A: A bacterium and a phage go through a process called lysogenic conversion, which is typically…
Q: Match each structure with its descriptions. ____ radula a. internal skeleton…
A: Human anatomy and physiology are concerned with how the human body works to keep itself alive and…
Step by step
Solved in 2 steps
- a. What are the advantages of the glucose peroxidase method of determining blood sugar? b. The principle of spectrophotometer is is based on _____ law. c. Differenciate hyperglycemia from hypoglycemia.Choose that, which leads to development of gastroesophageal reflux: O a. a-adrenergic agonists O b. foods with reach proteins O c.acetilcholine O d. histamine O e. fatty foods Hello My dear , i have only 15 minutes Please write only the correct Iron deficiency anemia is characterized by: 1) Hemic hypoxia 2) Hyperchromia 3) Trophic disorders 4) Respiratory hypoxia 5) Thrombocytopenia answer without explanation Iam waiting for you thank you for your time О а. 2,5 O b. 1,3 О с. 3,5 O d. 2,4 O e. 1,4Which of the following is a sign of diabetic ketoacidosis? Select one: A. Dysuria B. Diabetic foot C. Hypoglycemia D. Insulin shock E. Frequent and deep respiration O O
- Discusskey impairments that are characteristic in the altered glucose metabolism of people with Type 2 Diabetes. (note: you should describe effects in different key organs/tissues involved in glucose metabolism within your answer) As a result of these impairments, describethe expected differences in post-prandial metabolism of a given load of digestible carbohydrates in people with Type 2 Diabetes compared with healthy, non-diabetic individuals.Hypoglycemia comes about for various reasons and clinic symptoms usually occur at blood glucose concentrations: A.What is the most dangerous adverse effect following use of biguanides?A. Lactic acidosisB. HypoglycaemiaC. Diabetic ketoacidosisD. HyperosmolalityE. Hyperglycaemia
- Which of the following is a sign of diabetic ketoacidosis? Select one: A. Diabetic foot B. Dysuria C. Insulin shock D. Frequent and deep respiration E. HypoglycemiaWhat complication(s) is/are not commonly seen in patients with Type 2 Diabetes? (Select all that apply) Glomerular damage O Neuropathies O Ketotic Hyperosmolar states O Metabolic AcidosisWhich of the following statements is true regarding carbohydrate in the diabetic diet? a. Low-carbohydrate diets are recommended b. High-fiber, minimally processed carbohydrates should be emphasized O C. Artificial sweeteners should be avoided O d. Simple carbohydrates should be completely eleminated
- Answer the question.. A patient requires 40 units of NPH insulin and 10 units ofregular insulin daily subcutaneously. What is the correctsequence when mixing insulins?a. Inject air into the regular insulin vial and withdraw 10units; then, using the same syringe, inject air into the NPHvial and withdraw 40 units of NPH insulin.b. Inject air into the NPH insulin vial, being careful not toallow the solution to touch the needle; next, inject air into the regular insulin vial and withdraw 10 units; then, with-draw 40 units of NPH insulin. c. Inject air into the regular insulin vial, being careful not toallow the solution to touch the needle; next, inject air into the NPH insulin vial and withdraw 40 units; then, with-draw 10 units of regular insulin. d. Inject air into the NPH insulin vial and withdraw 40 units;then, using the same syringe, inject air into the regular.Side-effects of non-steroidal anti- inflammatory drugs (NSAIDS) include all, except Peptic ulcer Reduced kidney function GIT bleeding O Seizures Ketoprofen: is a propionic acid derivative that inhibits both COX (non selectively) and * lipoxygenase True FalseA patient with type I diabetes is found in a coma. Blood glucose, urine glucose, blood ketones, and urine ketones are all elevated; serum HCO3- is < 12 mEq/L. Respirations are quick and deep with acetone breath. Blood pressure is 95/61 mm Hg, and the pulse is weak and rapid (119 beats/min).What factor in this patient's condition is the major cause of their low serum HCO3-? * O The patient has been excreting acidic urine. O The patient has been hyperventilating. O The patient has compensated for the low cO2. O it has been depleted to buffer ketoacids. O The patient tries to achieve a normal (HC03-1/Pco2 ratio.